Incidental Mutation 'R7053:Rhou'
ID547718
Institutional Source Beutler Lab
Gene Symbol Rhou
Ensembl Gene ENSMUSG00000039960
Gene Nameras homolog family member U
Synonyms2310026M05Rik, WRCH-1, mG28K, CDC42L1, WRCH1, Arhu
MMRRC Submission
Accession Numbers

Genbank: NM_133955; MGI: 1916831

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123653929-123663884 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 123654195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045487] [ENSMUST00000127664]
Predicted Effect
SMART Domains Protein: ENSMUSP00000038915
Gene: ENSMUSG00000039960
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
RHO 55 228 5.59e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of GTPases. This protein can activate PAK1 and JNK1, and can induce filopodium formation and stress fiber dissolution. It may also mediate the effects of WNT1 signaling in the regulation of cell morphology, cytoskeletal organization, and cell proliferation. A non-coding transcript variant of this gene results from naturally occurring read-through transcription between this locus and the neighboring DUSP5P (dual specificity phosphatase 5 pseudogene) locus.[provided by RefSeq, Mar 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Rhou
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Rhou APN 8 123654141 missense possibly damaging 0.60
A5278:Rhou UTSW 8 123660991 missense probably damaging 0.99
R0926:Rhou UTSW 8 123660976 missense probably damaging 1.00
R1467:Rhou UTSW 8 123661290 missense possibly damaging 0.94
R1467:Rhou UTSW 8 123661290 missense possibly damaging 0.94
R1873:Rhou UTSW 8 123661251 missense probably damaging 1.00
R2276:Rhou UTSW 8 123655519 missense probably damaging 1.00
R2937:Rhou UTSW 8 123661141 missense possibly damaging 0.65
R5107:Rhou UTSW 8 123661173 nonsense probably null
R5176:Rhou UTSW 8 123654109 missense possibly damaging 0.90
R6172:Rhou UTSW 8 123661164 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTGTGGTCTCGGATAGAAGAAG -3'
(R):5'- AAGGAACGTTCTCGCAAGCC -3'

Sequencing Primer
(F):5'- TGTCGCAGGGAAGCCTG -3'
(R):5'- TTGCTCCAGGCGAAGATC -3'
Posted On2019-05-13