Incidental Mutation 'R7053:Rffl'
ID547724
Institutional Source Beutler Lab
Gene Symbol Rffl
Ensembl Gene ENSMUSG00000020696
Gene Namering finger and FYVE like domain containing protein
Synonyms1700051E09Rik, Carp-2, 4930516L10Rik, rififylin, fring, Carp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location82802449-82871210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82812671 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 142 (K142R)
Ref Sequence ENSEMBL: ENSMUSP00000115846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021036] [ENSMUST00000071152] [ENSMUST00000074515] [ENSMUST00000093975] [ENSMUST00000103218] [ENSMUST00000108173] [ENSMUST00000126660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021036
AA Change: K107R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021036
Gene: ENSMUSG00000020696
AA Change: K107R

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 3e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 288 322 3.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071152
AA Change: K142R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071150
Gene: ENSMUSG00000020696
AA Change: K142R

DomainStartEndE-ValueType
PDB:1Y02|A 62 180 1e-74 PDB
Blast:RING 82 123 2e-19 BLAST
low complexity region 198 210 N/A INTRINSIC
RING 351 385 3.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074515
AA Change: K107R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074108
Gene: ENSMUSG00000020696
AA Change: K107R

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 4e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 316 350 3.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093975
AA Change: K121R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091510
Gene: ENSMUSG00000020696
AA Change: K121R

DomainStartEndE-ValueType
PDB:1Y02|A 41 159 6e-75 PDB
Blast:RING 61 102 2e-19 BLAST
low complexity region 177 189 N/A INTRINSIC
RING 330 364 3.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103218
AA Change: K107R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099507
Gene: ENSMUSG00000020696
AA Change: K107R

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 1e-76 PDB
SCOP:d1vfya_ 46 86 9e-5 SMART
Blast:RING 47 88 4e-20 BLAST
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108173
AA Change: K107R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103808
Gene: ENSMUSG00000020696
AA Change: K107R

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 4e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 316 350 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126660
AA Change: K142R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115846
Gene: ENSMUSG00000020696
AA Change: K142R

DomainStartEndE-ValueType
PDB:1Y02|A 62 142 9e-50 PDB
SCOP:d1vfya_ 81 121 1e-3 SMART
Blast:RING 82 123 7e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating targeted mutation of this gene are born at the expected Mendelian frequency; they are viable and fertile and exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Rffl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rffl APN 11 82818484 missense probably damaging 1.00
IGL01120:Rffl APN 11 82806022 missense probably damaging 1.00
IGL01295:Rffl APN 11 82818457 missense probably damaging 1.00
IGL01635:Rffl APN 11 82812552 missense probably benign 0.00
R0127:Rffl UTSW 11 82812632 missense probably damaging 1.00
R0195:Rffl UTSW 11 82810163 missense probably damaging 1.00
R2125:Rffl UTSW 11 82818438 missense probably damaging 0.99
R5030:Rffl UTSW 11 82812717 nonsense probably null
R5104:Rffl UTSW 11 82812793 nonsense probably null
R5283:Rffl UTSW 11 82812789 missense probably damaging 1.00
R5483:Rffl UTSW 11 82812723 synonymous probably null
R5828:Rffl UTSW 11 82818418 missense probably damaging 1.00
R5974:Rffl UTSW 11 82806151 missense probably damaging 1.00
R6651:Rffl UTSW 11 82812779 missense probably damaging 1.00
R6951:Rffl UTSW 11 82845750 critical splice donor site probably null
R7587:Rffl UTSW 11 82810148 missense probably damaging 1.00
R7782:Rffl UTSW 11 82812769 nonsense probably null
R8192:Rffl UTSW 11 82812723 synonymous probably null
R8243:Rffl UTSW 11 82812795 missense probably damaging 1.00
RF009:Rffl UTSW 11 82845772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAGGTGACTTGTGCAG -3'
(R):5'- CTGTTCCTTCAAGCTGACGC -3'

Sequencing Primer
(F):5'- AGGAGGCACTGTGCTGG -3'
(R):5'- TCAAGCTGACGCGCTCTC -3'
Posted On2019-05-13