Incidental Mutation 'R7053:Gsdma3'
ID547727
Institutional Source Beutler Lab
Gene Symbol Gsdma3
Ensembl Gene ENSMUSG00000064224
Gene Namegasdermin A3
SynonymsGsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98626360-98638226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98629795 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 84 (M84K)
Ref Sequence ENSEMBL: ENSMUSP00000103132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073295] [ENSMUST00000104933] [ENSMUST00000107508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073295
AA Change: M84K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073022
Gene: ENSMUSG00000064224
AA Change: M84K

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 1.4e-132 PFAM
low complexity region 438 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104933
SMART Domains Protein: ENSMUSP00000100538
Gene: ENSMUSG00000078134

DomainStartEndE-ValueType
RRM 10 78 7.02e-19 SMART
low complexity region 97 142 N/A INTRINSIC
low complexity region 147 159 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107508
AA Change: M84K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103132
Gene: ENSMUSG00000064224
AA Change: M84K

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 9.5e-134 PFAM
low complexity region 429 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Gsdma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Michelin UTSW 11 98637573 missense probably damaging 0.98
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
PIT4486001:Gsdma3 UTSW 11 98638054 missense unknown
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1329:Gsdma3 UTSW 11 98632392 missense probably damaging 1.00
R1759:Gsdma3 UTSW 11 98635245 missense possibly damaging 0.93
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R1839:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
R7733:Gsdma3 UTSW 11 98635215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTGAAGGATGCTGTG -3'
(R):5'- GTCTTATCTTGGCTTCCAATTGCA -3'

Sequencing Primer
(F):5'- GGCCAGCCATCCTGACC -3'
(R):5'- ATTAGCCCTCTCTCAGATGTAGGG -3'
Posted On2019-05-13