Incidental Mutation 'R7053:Dnaic2'
ID547728
Institutional Source Beutler Lab
Gene Symbol Dnaic2
Ensembl Gene ENSMUSG00000034706
Gene Namedynein, axonemal, intermediate chain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location114727408-114757889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114738695 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000090126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
Predicted Effect probably damaging
Transcript: ENSMUST00000069325
AA Change: S183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092469
AA Change: S183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141762
AA Change: S183P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Dnaic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnaic2 APN 11 114751788 missense probably benign 0.37
IGL01548:Dnaic2 APN 11 114752942 missense probably damaging 1.00
IGL02719:Dnaic2 APN 11 114751911 missense probably damaging 1.00
IGL03236:Dnaic2 APN 11 114757249 unclassified probably benign
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0305:Dnaic2 UTSW 11 114752894 missense probably benign 0.09
R0472:Dnaic2 UTSW 11 114745189 splice site probably benign
R0711:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R1756:Dnaic2 UTSW 11 114750380 missense probably benign 0.02
R1861:Dnaic2 UTSW 11 114752951 missense possibly damaging 0.56
R1916:Dnaic2 UTSW 11 114732923 missense possibly damaging 0.88
R1981:Dnaic2 UTSW 11 114732929 missense probably damaging 1.00
R1983:Dnaic2 UTSW 11 114735856 splice site probably null
R2430:Dnaic2 UTSW 11 114757186 unclassified probably benign
R2510:Dnaic2 UTSW 11 114757167 unclassified probably benign
R3001:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3002:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3113:Dnaic2 UTSW 11 114751930 splice site probably null
R3803:Dnaic2 UTSW 11 114738725 missense probably benign
R3874:Dnaic2 UTSW 11 114732955 missense probably damaging 1.00
R4853:Dnaic2 UTSW 11 114745091 missense probably benign 0.03
R5267:Dnaic2 UTSW 11 114740467 missense probably benign 0.02
R6008:Dnaic2 UTSW 11 114752990 missense probably benign 0.01
R6024:Dnaic2 UTSW 11 114752908 missense possibly damaging 0.85
R6819:Dnaic2 UTSW 11 114745091 missense probably benign 0.00
R7143:Dnaic2 UTSW 11 114754250 missense possibly damaging 0.86
R7208:Dnaic2 UTSW 11 114757162 missense unknown
R7275:Dnaic2 UTSW 11 114757228 missense unknown
R7463:Dnaic2 UTSW 11 114754406 missense probably benign 0.07
R7779:Dnaic2 UTSW 11 114754409 missense possibly damaging 0.50
R7899:Dnaic2 UTSW 11 114738630 missense probably benign 0.21
RF012:Dnaic2 UTSW 11 114750416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACGCAGTCACATAGAC -3'
(R):5'- CGGGAAGAGACAAGAGCTTTCC -3'

Sequencing Primer
(F):5'- TAAACACCTACTTGGGGG -3'
(R):5'- GAGCTTTCCTCTTATCCCTGGTG -3'
Posted On2019-05-13