Mutagenetix > Incidental Mutations

Incidental Mutation 'R7053:Dip2c'

547733

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.732) question?

Stock #

R7053 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9610704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 838 (D838G)

Ref Sequence

ENSEMBL: ENSMUSP00000131238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

AlphaFold

E9PWR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: D868G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: D868G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: D838G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: D838G

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: D867G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: D867G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222280

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	T	8: 43,568,799	C551*	probably null	Het
Aldh1l1	C	A	6: 90,563,438	T235K	possibly damaging	Het
Atp6v0a2	A	G	5: 124,645,983	E257G	probably damaging	Het
AW146154	A	G	7: 41,482,564		probably null	Het
BC048507	T	C	13: 67,863,653	Y50H	probably benign	Het
Brip1	T	C	11: 86,192,965	N77D	possibly damaging	Het
Ccdc13	T	C	9: 121,833,838	E37G	probably damaging	Het
Col27a1	T	A	4: 63,333,167		probably benign	Het
Corin	T	A	5: 72,301,527	I960L	probably benign	Het
Csnk2b	A	G	17: 35,116,446		probably benign	Het
Cyp2d26	T	C	15: 82,792,600	S182G	probably benign	Het
Dennd1a	A	G	2: 37,961,654	L74P	probably damaging	Het
Dkkl1	G	T	7: 45,207,598	Q182K	probably damaging	Het
Dnaic2	T	C	11: 114,738,695	S183P	probably damaging	Het
Dnhd1	T	C	7: 105,694,954	L1835P	probably damaging	Het
Espl1	T	C	15: 102,316,893		probably null	Het
Fam160a2	C	T	7: 105,384,572	G479D	probably damaging	Het
Fam174a	C	T	1: 95,325,228	A185V	probably damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Grid2	G	T	6: 64,700,418	A74S	unknown	Het
Gsdma3	T	A	11: 98,629,795	M84K	possibly damaging	Het
Hlcs	A	T	16: 94,268,015	S262R	possibly damaging	Het
Lrp1	A	G	10: 127,541,094	C4205R	probably damaging	Het
Mdc1	C	T	17: 35,846,326	A181V	probably benign	Het
Mdga2	T	A	12: 66,689,384	I357F	probably benign	Het
Mfn1	A	G	3: 32,531,965	I21V	probably benign	Het
Mgat4b	C	T	11: 50,233,540	T409M	probably damaging	Het
Mgat4d	G	T	8: 83,371,632	K341N	probably damaging	Het
Mpo	A	T	11: 87,803,510	N109Y	probably damaging	Het
Mvp	T	C	7: 126,987,604	Q785R	possibly damaging	Het
Nim1k	A	G	13: 119,727,609	V88A	probably damaging	Het
Oasl2	A	T	5: 114,911,230	I464L	possibly damaging	Het
Olfr1029	G	T	2: 85,976,014	C257F	possibly damaging	Het
Pkd1l2	A	G	8: 117,013,942	F2139L	probably damaging	Het
Pop1	T	G	15: 34,530,275	S940A	probably benign	Het
Ppp1r9a	T	A	6: 4,905,670	M75K	probably damaging	Het
Prdm15	G	A	16: 97,794,542	Q1029*	probably null	Het
Rffl	T	C	11: 82,812,671	K142R	probably null	Het
Rhou	A	G	8: 123,654,195		probably benign	Het
Rp1l1	A	T	14: 64,031,509	T1515S	possibly damaging	Het
Serpina1b	T	A	12: 103,732,429	S54C	possibly damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Taok3	T	A	5: 117,252,562	D529E	probably benign	Het
Tmem18	T	A	12: 30,584,507	M1K	probably null	Het
Tmem269	T	A	4: 119,209,267	H198L	probably damaging	Het
Tnrc18	A	G	5: 142,787,229	V432A	unknown	Het
Ttc6	A	T	12: 57,660,532	T742S	probably benign	Het
Uhrf2	T	A	19: 30,092,119	C749S	probably damaging	Het
Unc13c	G	A	9: 73,932,297	T424I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r61	A	C	7: 42,267,133	D390A	probably damaging	Het
Wisp3	A	G	10: 39,158,301	Y102H	probably damaging	Het
Xpo7	A	G	14: 70,684,858		probably null	Het
Zfp948	T	A	17: 21,584,859	L37*	probably null	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01
R8779:Dip2c	UTSW	13	9610809	missense	probably damaging	0.98
R8786:Dip2c	UTSW	13	9615794	missense	probably damaging	0.99
R8815:Dip2c	UTSW	13	9623798	nonsense	probably null
R8833:Dip2c	UTSW	13	9575483	critical splice donor site	probably null
R8868:Dip2c	UTSW	13	9575467	missense	possibly damaging	0.73
R8873:Dip2c	UTSW	13	9575146	missense	probably benign	0.03
R8887:Dip2c	UTSW	13	9623953	splice site	probably benign
R8923:Dip2c	UTSW	13	9623865	missense	probably damaging	1.00
R9112:Dip2c	UTSW	13	9610730	missense	probably damaging	1.00
R9424:Dip2c	UTSW	13	9659395	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAAAATCCAACACCAGAGGTTATC -3'
(R):5'- AGATGTAGCCCCTCCTCAGC -3'

Sequencing Primer
(F):5'- TATCCTCTGTACAGTAAACACATGC -3'
(R):5'- TTCAGAGATCCATGGCATACCTGG -3'

Posted On

2019-05-13