Incidental Mutation 'R7053:Nim1k'
ID547735
Institutional Source Beutler Lab
Gene Symbol Nim1k
Ensembl Gene ENSMUSG00000095930
Gene NameNIM1 serine/threonine protein kinase
SynonymsE130304F04Rik, Nim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location119710094-119755882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119727609 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000136377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178142]
Predicted Effect probably damaging
Transcript: ENSMUST00000178142
AA Change: V88A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136377
Gene: ENSMUSG00000095930
AA Change: V88A

DomainStartEndE-ValueType
S_TKc 74 325 8.66e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Nim1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1334:Nim1k UTSW 13 119712488 missense probably benign 0.05
R1782:Nim1k UTSW 13 119712151 missense probably benign 0.00
R2216:Nim1k UTSW 13 119714215 missense probably damaging 0.99
R3710:Nim1k UTSW 13 119712099 missense probably benign
R4385:Nim1k UTSW 13 119712626 missense probably damaging 0.98
R4430:Nim1k UTSW 13 119712542 missense possibly damaging 0.63
R4484:Nim1k UTSW 13 119712174 nonsense probably null
R4812:Nim1k UTSW 13 119712384 missense probably benign
R5383:Nim1k UTSW 13 119727799 missense probably benign 0.25
R5436:Nim1k UTSW 13 119727529 intron probably benign
R5511:Nim1k UTSW 13 119727594 missense probably damaging 1.00
R6682:Nim1k UTSW 13 119712188 missense probably benign 0.09
R6922:Nim1k UTSW 13 119727727 missense probably damaging 0.99
R7455:Nim1k UTSW 13 119712459 missense probably damaging 1.00
R8168:Nim1k UTSW 13 119712752 missense probably damaging 1.00
R8333:Nim1k UTSW 13 119712486 missense probably damaging 1.00
Z1177:Nim1k UTSW 13 119727702 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCCTTCATTTCCCAAGAAAG -3'
(R):5'- TGGAAAGCAGCTGTCAGACC -3'

Sequencing Primer
(F):5'- CCAAGAAAGGGAGTAGTCTGTCTG -3'
(R):5'- AGCTGTCAGACCGAGGG -3'
Posted On2019-05-13