Incidental Mutation 'R7053:Rp1l1'
ID547736
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64031509 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1515 (T1515S)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058229
AA Change: T1515S

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: T1515S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
R7585:Rp1l1 UTSW 14 64030139 missense probably damaging 0.96
R7591:Rp1l1 UTSW 14 64026109 missense probably damaging 1.00
R7667:Rp1l1 UTSW 14 64029803 missense probably benign 0.04
R7862:Rp1l1 UTSW 14 64028027 missense probably damaging 1.00
R7935:Rp1l1 UTSW 14 64031225 missense probably damaging 0.99
R8256:Rp1l1 UTSW 14 64028153 missense probably benign 0.18
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Z1176:Rp1l1 UTSW 14 64029144 missense probably damaging 1.00
Z1177:Rp1l1 UTSW 14 64032297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCAGGAAGATCCAGAGCC -3'
(R):5'- TGAGACAACATCCTTCCTGTC -3'

Sequencing Primer
(F):5'- AGATCCAGAGCCGGGCAG -3'
(R):5'- TTCCTGTCCTCTGAGGGGC -3'
Posted On2019-05-13