Incidental Mutation 'R7053:Zfp948'
ID547743
Institutional Source Beutler Lab
Gene Symbol Zfp948
Ensembl Gene ENSMUSG00000067931
Gene Namezinc finger protein 948
SynonymsBC049807
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21567046-21588697 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21584859 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 37 (L37*)
Ref Sequence ENSEMBL: ENSMUSP00000086166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088787]
Predicted Effect probably null
Transcript: ENSMUST00000088787
AA Change: L37*
SMART Domains Protein: ENSMUSP00000086166
Gene: ENSMUSG00000067931
AA Change: L37*

DomainStartEndE-ValueType
KRAB 13 72 1.04e-21 SMART
low complexity region 164 173 N/A INTRINSIC
ZnF_C2H2 214 236 3.16e-3 SMART
ZnF_C2H2 242 264 9.58e-3 SMART
ZnF_C2H2 270 292 2.84e-5 SMART
ZnF_C2H2 298 320 8.22e-2 SMART
ZnF_C2H2 353 375 1.69e-3 SMART
ZnF_C2H2 381 403 9.88e-5 SMART
ZnF_C2H2 409 431 9.08e-4 SMART
ZnF_C2H2 437 459 2.2e-2 SMART
ZnF_C2H2 465 487 5.99e-4 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 5.21e-4 SMART
ZnF_C2H2 549 571 9.73e-4 SMART
ZnF_C2H2 577 599 2.43e-4 SMART
ZnF_C2H2 605 627 2.91e-2 SMART
ZnF_C2H2 633 655 4.72e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Other mutations in Zfp948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Zfp948 APN 17 21587071 missense probably benign 0.01
R0212:Zfp948 UTSW 17 21588160 missense probably benign 0.01
R0225:Zfp948 UTSW 17 21587294 missense probably damaging 1.00
R0433:Zfp948 UTSW 17 21587502 missense probably benign 0.02
R0437:Zfp948 UTSW 17 21586998 missense unknown
R0490:Zfp948 UTSW 17 21588034 missense probably benign 0.02
R1245:Zfp948 UTSW 17 21586842 missense probably damaging 1.00
R1818:Zfp948 UTSW 17 21584807 missense probably damaging 1.00
R2106:Zfp948 UTSW 17 21587691 nonsense probably null
R3692:Zfp948 UTSW 17 21587576 missense probably benign 0.01
R4767:Zfp948 UTSW 17 21588307 missense possibly damaging 0.61
R5226:Zfp948 UTSW 17 21588243 missense probably benign 0.00
R5753:Zfp948 UTSW 17 21586894 missense probably damaging 0.97
R5766:Zfp948 UTSW 17 21584816 missense probably benign 0.02
R5959:Zfp948 UTSW 17 21587514 missense probably benign 0.01
R6167:Zfp948 UTSW 17 21587649 missense probably benign 0.38
R6291:Zfp948 UTSW 17 21587024 missense unknown
R6312:Zfp948 UTSW 17 21587167 missense possibly damaging 0.56
R6482:Zfp948 UTSW 17 21587551 missense probably benign 0.01
R7046:Zfp948 UTSW 17 21588457 missense possibly damaging 0.80
R7207:Zfp948 UTSW 17 21588340 missense possibly damaging 0.52
R7222:Zfp948 UTSW 17 21587840 missense probably damaging 1.00
R7460:Zfp948 UTSW 17 21588415 missense probably damaging 1.00
R7760:Zfp948 UTSW 17 21588366 missense probably damaging 1.00
R7818:Zfp948 UTSW 17 21587723 missense probably benign 0.14
RF011:Zfp948 UTSW 17 21588312 missense probably damaging 0.97
X0023:Zfp948 UTSW 17 21586860 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACATGTCATCCTCCTTTCACAGAG -3'
(R):5'- ACTACCTAGACTTCTGGTTTGTTTG -3'

Sequencing Primer
(F):5'- CACAGAGTTTGAACATTCACTACAG -3'
(R):5'- TGGCTGCTTACTAGAGAG -3'
Posted On2019-05-13