Incidental Mutation 'R7054:Fmn1'
ID547757
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7054 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113365008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 351 (D351G)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: D351G
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: D351G
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: D351G
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik A G 17: 47,437,189 probably null Het
3632451O06Rik C A 14: 49,773,698 S184I probably damaging Het
4930553M12Rik T A 4: 88,868,249 H44L unknown Het
Abcc3 T C 11: 94,365,225 K478R probably benign Het
Ank2 A T 3: 126,943,303 probably benign Het
Apod A G 16: 31,311,132 V2A probably benign Het
Aspg T A 12: 112,126,390 D530E probably damaging Het
Atxn7 A T 14: 14,100,878 T855S probably benign Het
Blmh G C 11: 76,968,625 G351R probably damaging Het
Cc2d2a C T 5: 43,699,979 R454* probably null Het
Cenpp T C 13: 49,465,757 E188G probably damaging Het
Creg2 T C 1: 39,623,208 E252G probably benign Het
Dot1l A G 10: 80,787,023 Y636C probably damaging Het
Dpy30 A G 17: 74,307,840 I36T probably benign Het
Eed A G 7: 89,964,727 probably null Het
Fra10ac1 C T 19: 38,224,119 probably benign Het
Gdpd4 T A 7: 97,973,929 I249N probably damaging Het
Glb1l2 A T 9: 26,765,127 V600D probably null Het
Gm13889 A T 2: 93,957,114 probably benign Het
Gm17654 T A 14: 43,575,870 N188Y Het
Gm3327 T C 14: 44,126,275 F112S Het
H2-Ab1 T C 17: 34,263,342 S11P probably benign Het
Hcn4 T C 9: 58,855,717 S522P unknown Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hoxa1 A G 6: 52,158,200 S8P probably damaging Het
Hoxd13 A G 2: 74,669,025 Y239C probably damaging Het
Ifih1 T A 2: 62,610,515 I485L probably benign Het
Ift52 G A 2: 163,029,796 V183M probably damaging Het
Ikbkb A G 8: 22,671,642 V410A possibly damaging Het
Il22ra1 G A 4: 135,751,162 V515I probably benign Het
Klk1b3 A T 7: 44,201,439 I132F probably damaging Het
Limk2 T C 11: 3,355,448 T206A possibly damaging Het
Llph A T 10: 120,231,335 probably benign Het
Lrrc26 T A 2: 25,290,075 D29E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfhas1 T C 8: 35,588,638 V89A probably benign Het
Mycbp2 G A 14: 103,156,098 T2899I possibly damaging Het
Nckap5 A T 1: 126,258,712 probably null Het
Ncor1 T C 11: 62,384,793 D530G probably null Het
Olfr1117-ps1 T A 2: 87,284,431 M47K probably benign Het
Olfr681 C T 7: 105,121,963 R169* probably null Het
Pax4 A G 6: 28,446,323 I57T probably damaging Het
Peg12 T C 7: 62,463,963 I129V possibly damaging Het
Pex6 G A 17: 46,720,521 A416T probably benign Het
Pgghg G A 7: 140,944,718 R326H probably benign Het
Pgk2 T A 17: 40,208,475 M21L probably benign Het
Polh A T 17: 46,198,716 W64R probably benign Het
Rassf7 T A 7: 141,217,643 H256Q probably benign Het
Rc3h2 A G 2: 37,375,246 M1184T probably benign Het
Ror1 A T 4: 100,442,239 E936D probably benign Het
Slco1b2 A T 6: 141,672,248 T440S probably damaging Het
Specc1 T A 11: 62,117,778 V40E probably damaging Het
Tarbp1 T A 8: 126,474,495 S191C possibly damaging Het
Timm22 A G 11: 76,407,245 E14G possibly damaging Het
Tpp2 T A 1: 43,983,158 D905E probably damaging Het
Trav7-5 T C 14: 53,531,299 L108P probably damaging Het
Ttc37 G A 13: 76,134,960 A769T probably damaging Het
Ttc9b A G 7: 27,654,242 T106A probably benign Het
Ttn T C 2: 76,714,668 S32697G probably damaging Het
Usp17la T G 7: 104,861,307 L373R probably benign Het
Vmn1r113 A G 7: 20,787,502 N73S probably benign Het
Vmn1r42 T C 6: 89,845,069 T173A possibly damaging Het
Vmn2r106 A G 17: 20,278,920 V243A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Zc3h13 T C 14: 75,321,787 S379P probably benign Het
Zfp870 T C 17: 32,883,482 Y292C probably damaging Het
Zfp977 A T 7: 42,580,362 N246K possibly damaging Het
Zp1 G A 19: 10,918,740 T207M probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTCTGAAAGCCATGGG -3'
(R):5'- CTCTATCACCTTGCGGAGAACC -3'

Sequencing Primer
(F):5'- TGGGAAACATGCAGGGGC -3'
(R):5'- CTTGCGGAGAACCTTGTTCACAG -3'
Posted On2019-05-13