Incidental Mutation 'R0612:Lrrn2'
ID54776
Institutional Source Beutler Lab
Gene Symbol Lrrn2
Ensembl Gene ENSMUSG00000026443
Gene Nameleucine rich repeat protein 2, neuronal
SynonymsNLRR-2, 5730406J09Rik
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0612 (G1)
Quality Score149
Status Validated
Chromosome1
Chromosomal Location132880273-132940005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132937728 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 177 (L177P)
Ref Sequence ENSEMBL: ENSMUSP00000027706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027706]
Predicted Effect probably damaging
Transcript: ENSMUST00000027706
AA Change: L177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027706
Gene: ENSMUSG00000026443
AA Change: L177P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 28 73 2.22e-2 SMART
LRR 92 115 3.86e0 SMART
LRR 116 139 1.08e-1 SMART
LRR_TYP 140 163 3.21e-4 SMART
LRR 164 187 1.33e-1 SMART
LRR 188 211 5.89e1 SMART
LRR 212 235 1.66e1 SMART
LRR 236 259 4.98e-1 SMART
LRR 260 283 5.26e0 SMART
LRR 309 333 5.56e0 SMART
LRR 334 357 2.17e-1 SMART
LRRCT 369 421 3.13e-3 SMART
IGc2 436 504 9.99e-13 SMART
FN3 525 607 3.49e0 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159088
Meta Mutation Damage Score 0.9424 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibited numerous neurological abnormalities when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Lrrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Lrrn2 APN 1 132938358 missense possibly damaging 0.89
IGL01407:Lrrn2 APN 1 132937227 missense probably damaging 1.00
IGL01636:Lrrn2 APN 1 132937221 missense possibly damaging 0.95
IGL02134:Lrrn2 APN 1 132937817 missense possibly damaging 0.69
IGL02142:Lrrn2 APN 1 132939245 missense possibly damaging 0.86
IGL03240:Lrrn2 APN 1 132938327 missense possibly damaging 0.53
R0226:Lrrn2 UTSW 1 132937820 missense probably damaging 1.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1969:Lrrn2 UTSW 1 132939234 missense probably benign 0.00
R2087:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R3923:Lrrn2 UTSW 1 132938492 missense probably benign 0.45
R4006:Lrrn2 UTSW 1 132937740 missense probably damaging 1.00
R4022:Lrrn2 UTSW 1 132939114 missense probably benign
R4091:Lrrn2 UTSW 1 132937652 nonsense probably null
R4092:Lrrn2 UTSW 1 132937652 nonsense probably null
R4719:Lrrn2 UTSW 1 132939177 missense probably benign
R5285:Lrrn2 UTSW 1 132939245 missense possibly damaging 0.86
R5681:Lrrn2 UTSW 1 132937161 start gained probably benign
R5791:Lrrn2 UTSW 1 132937767 missense probably benign 0.00
R5916:Lrrn2 UTSW 1 132937800 missense probably damaging 1.00
R6646:Lrrn2 UTSW 1 132939056 missense probably benign
R7021:Lrrn2 UTSW 1 132938784 missense probably damaging 1.00
R7686:Lrrn2 UTSW 1 132938594 missense probably benign 0.04
R7811:Lrrn2 UTSW 1 132939201 missense probably benign
R7869:Lrrn2 UTSW 1 132939378 missense unknown
R7952:Lrrn2 UTSW 1 132939378 missense unknown
R8004:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
Z1177:Lrrn2 UTSW 1 132937898 nonsense probably null
Z1177:Lrrn2 UTSW 1 132938978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGCTTCTCAGATGCCCGAGAC -3'
(R):5'- GAAAGAGAGACTCTCCAGGCTTTGC -3'

Sequencing Primer
(F):5'- GAGACTGCGATTTCCAAGC -3'
(R):5'- TTGCAGTCCCTCCAGAGC -3'
Posted On2013-07-11