Incidental Mutation 'R7054:Il22ra1'
ID547763
Institutional Source Beutler Lab
Gene Symbol Il22ra1
Ensembl Gene ENSMUSG00000037157
Gene Nameinterleukin 22 receptor, alpha 1
SynonymsIl22r
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7054 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135728172-135752140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135751162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 515 (V515I)
Ref Sequence ENSEMBL: ENSMUSP00000099605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102546]
Predicted Effect probably benign
Transcript: ENSMUST00000102546
AA Change: V515I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099605
Gene: ENSMUSG00000037157
AA Change: V515I

DomainStartEndE-ValueType
Pfam:Tissue_fac 4 106 1.1e-29 PFAM
Pfam:Interfer-bind 119 214 7.5e-7 PFAM
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik A G 17: 47,437,189 probably null Het
3632451O06Rik C A 14: 49,773,698 S184I probably damaging Het
4930553M12Rik T A 4: 88,868,249 H44L unknown Het
Abcc3 T C 11: 94,365,225 K478R probably benign Het
Ank2 A T 3: 126,943,303 probably benign Het
Apod A G 16: 31,311,132 V2A probably benign Het
Aspg T A 12: 112,126,390 D530E probably damaging Het
Atxn7 A T 14: 14,100,878 T855S probably benign Het
Blmh G C 11: 76,968,625 G351R probably damaging Het
Cc2d2a C T 5: 43,699,979 R454* probably null Het
Cenpp T C 13: 49,465,757 E188G probably damaging Het
Creg2 T C 1: 39,623,208 E252G probably benign Het
Dot1l A G 10: 80,787,023 Y636C probably damaging Het
Dpy30 A G 17: 74,307,840 I36T probably benign Het
Eed A G 7: 89,964,727 probably null Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fra10ac1 C T 19: 38,224,119 probably benign Het
Gdpd4 T A 7: 97,973,929 I249N probably damaging Het
Glb1l2 A T 9: 26,765,127 V600D probably null Het
Gm13889 A T 2: 93,957,114 probably benign Het
Gm17654 T A 14: 43,575,870 N188Y Het
Gm3327 T C 14: 44,126,275 F112S Het
H2-Ab1 T C 17: 34,263,342 S11P probably benign Het
Hcn4 T C 9: 58,855,717 S522P unknown Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hoxa1 A G 6: 52,158,200 S8P probably damaging Het
Hoxd13 A G 2: 74,669,025 Y239C probably damaging Het
Ifih1 T A 2: 62,610,515 I485L probably benign Het
Ift52 G A 2: 163,029,796 V183M probably damaging Het
Ikbkb A G 8: 22,671,642 V410A possibly damaging Het
Klk1b3 A T 7: 44,201,439 I132F probably damaging Het
Limk2 T C 11: 3,355,448 T206A possibly damaging Het
Llph A T 10: 120,231,335 probably benign Het
Lrrc26 T A 2: 25,290,075 D29E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfhas1 T C 8: 35,588,638 V89A probably benign Het
Mycbp2 G A 14: 103,156,098 T2899I possibly damaging Het
Nckap5 A T 1: 126,258,712 probably null Het
Ncor1 T C 11: 62,384,793 D530G probably null Het
Olfr1117-ps1 T A 2: 87,284,431 M47K probably benign Het
Olfr681 C T 7: 105,121,963 R169* probably null Het
Pax4 A G 6: 28,446,323 I57T probably damaging Het
Peg12 T C 7: 62,463,963 I129V possibly damaging Het
Pex6 G A 17: 46,720,521 A416T probably benign Het
Pgghg G A 7: 140,944,718 R326H probably benign Het
Pgk2 T A 17: 40,208,475 M21L probably benign Het
Polh A T 17: 46,198,716 W64R probably benign Het
Rassf7 T A 7: 141,217,643 H256Q probably benign Het
Rc3h2 A G 2: 37,375,246 M1184T probably benign Het
Ror1 A T 4: 100,442,239 E936D probably benign Het
Slco1b2 A T 6: 141,672,248 T440S probably damaging Het
Specc1 T A 11: 62,117,778 V40E probably damaging Het
Tarbp1 T A 8: 126,474,495 S191C possibly damaging Het
Timm22 A G 11: 76,407,245 E14G possibly damaging Het
Tpp2 T A 1: 43,983,158 D905E probably damaging Het
Trav7-5 T C 14: 53,531,299 L108P probably damaging Het
Ttc37 G A 13: 76,134,960 A769T probably damaging Het
Ttc9b A G 7: 27,654,242 T106A probably benign Het
Ttn T C 2: 76,714,668 S32697G probably damaging Het
Usp17la T G 7: 104,861,307 L373R probably benign Het
Vmn1r113 A G 7: 20,787,502 N73S probably benign Het
Vmn1r42 T C 6: 89,845,069 T173A possibly damaging Het
Vmn2r106 A G 17: 20,278,920 V243A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Zc3h13 T C 14: 75,321,787 S379P probably benign Het
Zfp870 T C 17: 32,883,482 Y292C probably damaging Het
Zfp977 A T 7: 42,580,362 N246K possibly damaging Het
Zp1 G A 19: 10,918,740 T207M probably damaging Het
Other mutations in Il22ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Il22ra1 APN 4 135751084 missense possibly damaging 0.84
IGL01480:Il22ra1 APN 4 135744801 missense probably benign 0.03
IGL02533:Il22ra1 APN 4 135744723 missense possibly damaging 0.94
R0137:Il22ra1 UTSW 4 135751006 missense probably benign 0.00
R0196:Il22ra1 UTSW 4 135734245 missense possibly damaging 0.67
R1647:Il22ra1 UTSW 4 135750460 missense probably damaging 0.98
R1800:Il22ra1 UTSW 4 135748160 missense probably benign 0.10
R1901:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1902:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1903:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1906:Il22ra1 UTSW 4 135751233 missense probably damaging 1.00
R4278:Il22ra1 UTSW 4 135750713 missense possibly damaging 0.93
R4404:Il22ra1 UTSW 4 135737431 missense possibly damaging 0.56
R5001:Il22ra1 UTSW 4 135733104 missense probably damaging 1.00
R6666:Il22ra1 UTSW 4 135750461 missense probably damaging 0.98
R7615:Il22ra1 UTSW 4 135737459 missense probably benign 0.16
R7644:Il22ra1 UTSW 4 135733035 missense probably damaging 1.00
R7754:Il22ra1 UTSW 4 135734250 missense probably benign 0.01
R7808:Il22ra1 UTSW 4 135750796 missense possibly damaging 0.93
R8024:Il22ra1 UTSW 4 135734278 missense probably benign 0.43
Z1177:Il22ra1 UTSW 4 135737406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTAGAAGCTGTCTCCCAGG -3'
(R):5'- CCAAGCCTTTGAAAAGAGAGTCC -3'

Sequencing Primer
(F):5'- TCTCTACAGAAAGTCACCTCCTTAG -3'
(R):5'- GCCTTTGAAAAGAGAGTCCAGTTC -3'
Posted On2019-05-13