Incidental Mutation 'R7054:Hfm1'
ID547765
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7054 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106896043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 576 (T576A)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: T576A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: T576A

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: T576A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: T576A

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik A G 17: 47,437,189 probably null Het
3632451O06Rik C A 14: 49,773,698 S184I probably damaging Het
4930553M12Rik T A 4: 88,868,249 H44L unknown Het
Abcc3 T C 11: 94,365,225 K478R probably benign Het
Ank2 A T 3: 126,943,303 probably benign Het
Apod A G 16: 31,311,132 V2A probably benign Het
Aspg T A 12: 112,126,390 D530E probably damaging Het
Atxn7 A T 14: 14,100,878 T855S probably benign Het
Blmh G C 11: 76,968,625 G351R probably damaging Het
Cc2d2a C T 5: 43,699,979 R454* probably null Het
Cenpp T C 13: 49,465,757 E188G probably damaging Het
Creg2 T C 1: 39,623,208 E252G probably benign Het
Dot1l A G 10: 80,787,023 Y636C probably damaging Het
Dpy30 A G 17: 74,307,840 I36T probably benign Het
Eed A G 7: 89,964,727 probably null Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fra10ac1 C T 19: 38,224,119 probably benign Het
Gdpd4 T A 7: 97,973,929 I249N probably damaging Het
Glb1l2 A T 9: 26,765,127 V600D probably null Het
Gm13889 A T 2: 93,957,114 probably benign Het
Gm17654 T A 14: 43,575,870 N188Y Het
Gm3327 T C 14: 44,126,275 F112S Het
H2-Ab1 T C 17: 34,263,342 S11P probably benign Het
Hcn4 T C 9: 58,855,717 S522P unknown Het
Hoxa1 A G 6: 52,158,200 S8P probably damaging Het
Hoxd13 A G 2: 74,669,025 Y239C probably damaging Het
Ifih1 T A 2: 62,610,515 I485L probably benign Het
Ift52 G A 2: 163,029,796 V183M probably damaging Het
Ikbkb A G 8: 22,671,642 V410A possibly damaging Het
Il22ra1 G A 4: 135,751,162 V515I probably benign Het
Klk1b3 A T 7: 44,201,439 I132F probably damaging Het
Limk2 T C 11: 3,355,448 T206A possibly damaging Het
Llph A T 10: 120,231,335 probably benign Het
Lrrc26 T A 2: 25,290,075 D29E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfhas1 T C 8: 35,588,638 V89A probably benign Het
Mycbp2 G A 14: 103,156,098 T2899I possibly damaging Het
Nckap5 A T 1: 126,258,712 probably null Het
Ncor1 T C 11: 62,384,793 D530G probably null Het
Olfr1117-ps1 T A 2: 87,284,431 M47K probably benign Het
Olfr681 C T 7: 105,121,963 R169* probably null Het
Pax4 A G 6: 28,446,323 I57T probably damaging Het
Peg12 T C 7: 62,463,963 I129V possibly damaging Het
Pex6 G A 17: 46,720,521 A416T probably benign Het
Pgghg G A 7: 140,944,718 R326H probably benign Het
Pgk2 T A 17: 40,208,475 M21L probably benign Het
Polh A T 17: 46,198,716 W64R probably benign Het
Rassf7 T A 7: 141,217,643 H256Q probably benign Het
Rc3h2 A G 2: 37,375,246 M1184T probably benign Het
Ror1 A T 4: 100,442,239 E936D probably benign Het
Slco1b2 A T 6: 141,672,248 T440S probably damaging Het
Specc1 T A 11: 62,117,778 V40E probably damaging Het
Tarbp1 T A 8: 126,474,495 S191C possibly damaging Het
Timm22 A G 11: 76,407,245 E14G possibly damaging Het
Tpp2 T A 1: 43,983,158 D905E probably damaging Het
Trav7-5 T C 14: 53,531,299 L108P probably damaging Het
Ttc37 G A 13: 76,134,960 A769T probably damaging Het
Ttc9b A G 7: 27,654,242 T106A probably benign Het
Ttn T C 2: 76,714,668 S32697G probably damaging Het
Usp17la T G 7: 104,861,307 L373R probably benign Het
Vmn1r113 A G 7: 20,787,502 N73S probably benign Het
Vmn1r42 T C 6: 89,845,069 T173A possibly damaging Het
Vmn2r106 A G 17: 20,278,920 V243A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Zc3h13 T C 14: 75,321,787 S379P probably benign Het
Zfp870 T C 17: 32,883,482 Y292C probably damaging Het
Zfp977 A T 7: 42,580,362 N246K possibly damaging Het
Zp1 G A 19: 10,918,740 T207M probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACTGTAATATGGATGCACAGTTC -3'
(R):5'- GCATATTCTATAAGGGATTCAAAGCTG -3'

Sequencing Primer
(F):5'- TCTGTAACAAGATCTGGCGC -3'
(R):5'- TCTATAAGGGATTCAAAGCTGAAAGG -3'
Posted On2019-05-13