Mutagenetix > Incidental Mutation

Incidental Mutation 'R7054:Vmn2r111'

547808

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R7054 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (67/71)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	A	G	17: 47,437,189		probably null	Het
3632451O06Rik	C	A	14: 49,773,698	S184I	probably damaging	Het
4930553M12Rik	T	A	4: 88,868,249	H44L	unknown	Het
Abcc3	T	C	11: 94,365,225	K478R	probably benign	Het
Ank2	A	T	3: 126,943,303		probably benign	Het
Apod	A	G	16: 31,311,132	V2A	probably benign	Het
Aspg	T	A	12: 112,126,390	D530E	probably damaging	Het
Atxn7	A	T	14: 14,100,878	T855S	probably benign	Het
Blmh	G	C	11: 76,968,625	G351R	probably damaging	Het
Cc2d2a	C	T	5: 43,699,979	R454*	probably null	Het
Cenpp	T	C	13: 49,465,757	E188G	probably damaging	Het
Creg2	T	C	1: 39,623,208	E252G	probably benign	Het
Dot1l	A	G	10: 80,787,023	Y636C	probably damaging	Het
Dpy30	A	G	17: 74,307,840	I36T	probably benign	Het
Eed	A	G	7: 89,964,727		probably null	Het
Fmn1	A	G	2: 113,365,008	D351G	unknown	Het
Fra10ac1	C	T	19: 38,224,119		probably benign	Het
Gdpd4	T	A	7: 97,973,929	I249N	probably damaging	Het
Glb1l2	A	T	9: 26,765,127	V600D	probably null	Het
Gm13889	A	T	2: 93,957,114		probably benign	Het
Gm17654	T	A	14: 43,575,870	N188Y		Het
Gm3327	T	C	14: 44,126,275	F112S		Het
H2-Ab1	T	C	17: 34,263,342	S11P	probably benign	Het
Hcn4	T	C	9: 58,855,717	S522P	unknown	Het
Hfm1	T	C	5: 106,896,043	T576A	probably benign	Het
Hoxa1	A	G	6: 52,158,200	S8P	probably damaging	Het
Hoxd13	A	G	2: 74,669,025	Y239C	probably damaging	Het
Ifih1	T	A	2: 62,610,515	I485L	probably benign	Het
Ift52	G	A	2: 163,029,796	V183M	probably damaging	Het
Ikbkb	A	G	8: 22,671,642	V410A	possibly damaging	Het
Il22ra1	G	A	4: 135,751,162	V515I	probably benign	Het
Klk1b3	A	T	7: 44,201,439	I132F	probably damaging	Het
Limk2	T	C	11: 3,355,448	T206A	possibly damaging	Het
Llph	A	T	10: 120,231,335		probably benign	Het
Lrrc26	T	A	2: 25,290,075	D29E	probably benign	Het
Ltbp4	A	G	7: 27,307,766		probably null	Het
Mageb3	A	T	2: 121,954,492	V243E	probably damaging	Het
Mfhas1	T	C	8: 35,588,638	V89A	probably benign	Het
Mycbp2	G	A	14: 103,156,098	T2899I	possibly damaging	Het
Nckap5	A	T	1: 126,258,712		probably null	Het
Ncor1	T	C	11: 62,384,793	D530G	probably null	Het
Olfr1117-ps1	T	A	2: 87,284,431	M47K	probably benign	Het
Olfr681	C	T	7: 105,121,963	R169*	probably null	Het
Pax4	A	G	6: 28,446,323	I57T	probably damaging	Het
Peg12	T	C	7: 62,463,963	I129V	possibly damaging	Het
Pex6	G	A	17: 46,720,521	A416T	probably benign	Het
Pgghg	G	A	7: 140,944,718	R326H	probably benign	Het
Pgk2	T	A	17: 40,208,475	M21L	probably benign	Het
Polh	A	T	17: 46,198,716	W64R	probably benign	Het
Rassf7	T	A	7: 141,217,643	H256Q	probably benign	Het
Rc3h2	A	G	2: 37,375,246	M1184T	probably benign	Het
Ror1	A	T	4: 100,442,239	E936D	probably benign	Het
Slco1b2	A	T	6: 141,672,248	T440S	probably damaging	Het
Specc1	T	A	11: 62,117,778	V40E	probably damaging	Het
Tarbp1	T	A	8: 126,474,495	S191C	possibly damaging	Het
Timm22	A	G	11: 76,407,245	E14G	possibly damaging	Het
Tpp2	T	A	1: 43,983,158	D905E	probably damaging	Het
Trav7-5	T	C	14: 53,531,299	L108P	probably damaging	Het
Ttc37	G	A	13: 76,134,960	A769T	probably damaging	Het
Ttc9b	A	G	7: 27,654,242	T106A	probably benign	Het
Ttn	T	C	2: 76,714,668	S32697G	probably damaging	Het
Usp17la	T	G	7: 104,861,307	L373R	probably benign	Het
Vmn1r113	A	G	7: 20,787,502	N73S	probably benign	Het
Vmn1r42	T	C	6: 89,845,069	T173A	possibly damaging	Het
Vmn2r106	A	G	17: 20,278,920	V243A	probably damaging	Het
Vmn2r25	T	A	6: 123,823,610	D591V	probably damaging	Het
Zc3h13	T	C	14: 75,321,787	S379P	probably benign	Het
Zfp870	T	C	17: 32,883,482	Y292C	probably damaging	Het
Zfp977	A	T	7: 42,580,362	N246K	possibly damaging	Het
Zp1	G	A	19: 10,918,740	T207M	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GAGTAACTTAGGACAGAGATGt -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2019-05-13