Incidental Mutation 'R7055:Ptprc'
ID547823
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138089571 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 483 (I483T)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: I483T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: I483T

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: I459T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: I459T

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: I622T

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
bletchley UTSW 1 138117862 missense probably benign
Blush UTSW 1 138117720 intron probably benign
bruise UTSW 1 138064771 missense probably damaging 1.00
chor_muang UTSW 1 138113562 critical splice donor site probably null
crystal UTSW 1 138072255 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
Gentian UTSW 1 138067885 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
mauve UTSW 1 138099685 missense probably benign
Perverse UTSW 1 138101044 missense probably benign 0.02
ultra UTSW 1 138078445 critical splice donor site probably null
violaceous UTSW 1 138083639 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
R6995:Ptprc UTSW 1 138088744 missense probably damaging 1.00
R7009:Ptprc UTSW 1 138064553 missense probably damaging 0.97
R7041:Ptprc UTSW 1 138126309 missense probably benign 0.04
R7098:Ptprc UTSW 1 138099685 missense probably benign
R7164:Ptprc UTSW 1 138117862 missense probably benign
R7188:Ptprc UTSW 1 138071180 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138101044 missense probably benign 0.02
R7204:Ptprc UTSW 1 138117862 missense probably benign
R7316:Ptprc UTSW 1 138064771 missense probably damaging 1.00
R7644:Ptprc UTSW 1 138067907 missense probably benign 0.01
R7948:Ptprc UTSW 1 138064576 missense probably benign 0.45
R8029:Ptprc UTSW 1 138078459 missense probably damaging 1.00
Z1177:Ptprc UTSW 1 138067907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGCCTATTGTGAGTGGC -3'
(R):5'- ACTGGGGTACAAGATTTAGAAGTCC -3'

Sequencing Primer
(F):5'- TGCCCGGTGGATAAATTATTAAGGC -3'
(R):5'- GTGCATGCAGATCTGATG -3'
Posted On2019-05-13