Incidental Mutation 'R7055:Cdan1'
ID547826
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Namecongenital dyserythropoietic anemia, type I (human)
Synonymscodanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120716154-120850128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120727861 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 490 (I490T)
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110700
AA Change: I490T

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: I490T

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110701
AA Change: I490T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: I490T

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7316:Cdan1 UTSW 2 120728332 critical splice donor site probably null
R7325:Cdan1 UTSW 2 120724704 missense probably benign 0.25
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7517:Cdan1 UTSW 2 120727924 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAACAAGTGCATGGCATCC -3'
(R):5'- TATGGGGTTAAAGACTGGCACTG -3'

Sequencing Primer
(F):5'- CATCCCTGGGATTGAGAAGC -3'
(R):5'- CACTGTGGGCAGGCTTATCTTAAAC -3'
Posted On2019-05-13