Incidental Mutation 'R7055:Msantd1'
ID 547844
Institutional Source Beutler Lab
Gene Symbol Msantd1
Ensembl Gene ENSMUSG00000051246
Gene Name Myb/SANT-like DNA-binding domain containing 1
Synonyms A930005I04Rik, LOC231132
MMRRC Submission 045152-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 35071581-35084333 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 35075005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 9 (N9K)
Ref Sequence ENSEMBL: ENSMUSP00000148522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050535] [ENSMUST00000202205] [ENSMUST00000212362]
AlphaFold Q8BIL2
Predicted Effect probably benign
Transcript: ENSMUST00000050535
AA Change: N22K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057362
Gene: ENSMUSG00000051246
AA Change: N22K

DomainStartEndE-ValueType
Pfam:Myb_DNA-bind_4 43 131 1.1e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
coiled coil region 215 246 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202205
AA Change: N22K
SMART Domains Protein: ENSMUSP00000144008
Gene: ENSMUSG00000051246
AA Change: N22K

DomainStartEndE-ValueType
Pfam:Myb_DNA-bind_4 43 129 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212362
AA Change: N9K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,062,083 (GRCm39) S178P probably damaging Het
2610008E11Rik C T 10: 78,903,681 (GRCm39) E212K probably damaging Het
Abcc4 A T 14: 118,832,197 (GRCm39) L736* probably null Het
Acmsd A T 1: 127,681,570 (GRCm39) M178L probably benign Het
Adpgk T A 9: 59,220,476 (GRCm39) M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 (GRCm39) R149H possibly damaging Het
Aox1 A G 1: 58,338,927 (GRCm39) T307A probably benign Het
C1galt1 T C 6: 7,866,585 (GRCm39) Y144H probably damaging Het
Cabin1 G C 10: 75,579,117 (GRCm39) Q440E probably benign Het
Casq2 A G 3: 102,049,561 (GRCm39) S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Cdan1 A G 2: 120,558,342 (GRCm39) I490T probably damaging Het
Cep170b T A 12: 112,702,149 (GRCm39) V314E probably damaging Het
Col4a4 T C 1: 82,496,757 (GRCm39) E413G unknown Het
Cyp3a25 A C 5: 145,929,801 (GRCm39) F189L probably benign Het
Dido1 T A 2: 180,303,002 (GRCm39) H1634L probably benign Het
Dnaja2 A C 8: 86,275,303 (GRCm39) V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 (GRCm39) probably null Het
Eomes A T 9: 118,309,567 (GRCm39) N240I possibly damaging Het
Fads6 A G 11: 115,176,229 (GRCm39) F199L probably benign Het
Fbrs T C 7: 127,086,956 (GRCm39) probably null Het
Fndc4 T C 5: 31,451,522 (GRCm39) E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,954,775 (GRCm39) probably null Het
Fzr1 T C 10: 81,206,057 (GRCm39) Y210C probably damaging Het
Gjc2 T A 11: 59,067,856 (GRCm39) M209L unknown Het
Gpr33 A G 12: 52,071,036 (GRCm39) M1T probably null Het
Gtf2a1 A T 12: 91,553,523 (GRCm39) I28N possibly damaging Het
Igf2r A C 17: 12,923,210 (GRCm39) Y1200D probably damaging Het
Ivd C T 2: 118,703,730 (GRCm39) T212I probably damaging Het
Jag1 A G 2: 136,957,409 (GRCm39) V101A probably benign Het
Kansl3 A T 1: 36,404,701 (GRCm39) V83D possibly damaging Het
Krt81 T A 15: 101,359,006 (GRCm39) I249F probably benign Het
Krtap21-1 G A 16: 89,200,591 (GRCm39) S17L unknown Het
Macf1 A T 4: 123,302,989 (GRCm39) H504Q probably benign Het
Map2 A G 1: 66,455,983 (GRCm39) T1499A probably damaging Het
Map3k9 T C 12: 81,770,982 (GRCm39) T892A probably damaging Het
Mcl1 G A 3: 95,567,110 (GRCm39) V178I probably benign Het
Mrs2 T A 13: 25,188,937 (GRCm39) M126L probably benign Het
Myh9 C T 15: 77,659,398 (GRCm39) R116H probably damaging Het
Nfib A T 4: 82,248,662 (GRCm39) D308E probably benign Het
Nme2 T A 11: 93,846,416 (GRCm39) I11F probably damaging Het
Nmnat3 A G 9: 98,292,286 (GRCm39) D111G probably benign Het
Or5d37 T A 2: 87,924,045 (GRCm39) L78F probably damaging Het
Papss2 T C 19: 32,641,827 (GRCm39) W501R probably damaging Het
Parn A G 16: 13,443,998 (GRCm39) I384T possibly damaging Het
Pcdhb18 A G 18: 37,623,864 (GRCm39) D398G possibly damaging Het
Pdcl2 T C 5: 76,465,771 (GRCm39) N102D probably benign Het
Pdzrn3 C A 6: 101,128,735 (GRCm39) E644* probably null Het
Pi4ka T A 16: 17,134,879 (GRCm39) probably benign Het
Polg2 A G 11: 106,668,040 (GRCm39) F216L probably damaging Het
Prkcsh A G 9: 21,924,457 (GRCm39) *522W probably null Het
Prkcz G T 4: 155,374,091 (GRCm39) D108E probably benign Het
Pros1 T C 16: 62,748,465 (GRCm39) V646A possibly damaging Het
Ptprc A G 1: 138,017,309 (GRCm39) I483T probably damaging Het
Rabep2 T C 7: 126,044,485 (GRCm39) I527T possibly damaging Het
Rad50 T C 11: 53,578,929 (GRCm39) K543R probably benign Het
Samd4b A G 7: 28,103,458 (GRCm39) I553T probably benign Het
Sbpl A T 17: 24,172,276 (GRCm39) N214K unknown Het
Scgb2b11 C T 7: 31,909,907 (GRCm39) E60K possibly damaging Het
Sgk3 G A 1: 9,956,284 (GRCm39) E331K probably damaging Het
Snx6 A T 12: 54,830,864 (GRCm39) L32Q probably damaging Het
Srgap3 T A 6: 112,723,924 (GRCm39) Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 (GRCm39) D135G probably damaging Het
Steap4 A G 5: 8,026,858 (GRCm39) T274A probably damaging Het
Svep1 A T 4: 58,064,275 (GRCm39) V3236D probably benign Het
Svep1 A T 4: 58,120,642 (GRCm39) F797Y probably benign Het
Tmem116 T C 5: 121,605,987 (GRCm39) L113P probably damaging Het
Tnfrsf1b A G 4: 144,951,457 (GRCm39) V161A probably damaging Het
Tnpo1 G T 13: 98,991,987 (GRCm39) Q622K possibly damaging Het
Top1mt A G 15: 75,550,523 (GRCm39) V28A probably benign Het
Trim25 T C 11: 88,890,750 (GRCm39) S146P probably benign Het
Tuba3b A G 6: 145,566,935 (GRCm39) D392G possibly damaging Het
Utrn C T 10: 12,623,665 (GRCm39) R191Q probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdfy2 T A 14: 63,137,748 (GRCm39) S84T probably benign Het
Zfp873 T A 10: 81,895,832 (GRCm39) F225I probably damaging Het
Other mutations in Msantd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Msantd1 APN 5 35,078,887 (GRCm39) missense probably damaging 0.99
IGL02998:Msantd1 APN 5 35,078,768 (GRCm39) missense probably damaging 1.00
G1patch:Msantd1 UTSW 5 35,078,765 (GRCm39) missense probably damaging 1.00
R0538:Msantd1 UTSW 5 35,075,069 (GRCm39) missense probably damaging 1.00
R1658:Msantd1 UTSW 5 35,078,906 (GRCm39) missense probably benign 0.43
R1658:Msantd1 UTSW 5 35,078,905 (GRCm39) missense probably damaging 0.99
R3745:Msantd1 UTSW 5 35,080,811 (GRCm39) missense possibly damaging 0.94
R5241:Msantd1 UTSW 5 35,078,813 (GRCm39) missense probably damaging 1.00
R6009:Msantd1 UTSW 5 35,075,049 (GRCm39) missense probably benign 0.45
R6406:Msantd1 UTSW 5 35,080,665 (GRCm39) splice site probably null
R6725:Msantd1 UTSW 5 35,078,765 (GRCm39) missense probably damaging 1.00
R7327:Msantd1 UTSW 5 35,075,039 (GRCm39) missense probably damaging 1.00
R9265:Msantd1 UTSW 5 35,080,861 (GRCm39) nonsense probably null
R9279:Msantd1 UTSW 5 35,080,885 (GRCm39) missense probably benign
R9623:Msantd1 UTSW 5 35,075,076 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCTCTGTTGCTATGGAAAC -3'
(R):5'- TCAAAGAGCTTGCTGGCCATC -3'

Sequencing Primer
(F):5'- TGACATCAAAATGACGTTTCCCG -3'
(R):5'- AGAGCTTGCTGGCCATCTTCTC -3'
Posted On 2019-05-13