Incidental Mutation 'R7055:Pdcl2'
ID547845
Institutional Source Beutler Lab
Gene Symbol Pdcl2
Ensembl Gene ENSMUSG00000029235
Gene Namephosducin-like 2
Synonyms1700010B22Rik, 1700016K07Rik, Mgcphlp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76312115-76331156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76317924 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 102 (N102D)
Ref Sequence ENSEMBL: ENSMUSP00000113699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031145] [ENSMUST00000122213]
Predicted Effect probably benign
Transcript: ENSMUST00000031145
AA Change: N150D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031145
Gene: ENSMUSG00000029235
AA Change: N150D

DomainStartEndE-ValueType
Pfam:Phosducin 8 208 3.8e-20 PFAM
low complexity region 229 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122213
AA Change: N102D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113699
Gene: ENSMUSG00000029235
AA Change: N102D

DomainStartEndE-ValueType
Pfam:Phosducin 1 178 2.3e-19 PFAM
low complexity region 181 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Pdcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Pdcl2 APN 5 76325112 missense probably damaging 1.00
IGL00796:Pdcl2 APN 5 76319175 missense probably damaging 0.99
IGL02310:Pdcl2 APN 5 76317881 missense probably damaging 1.00
IGL02332:Pdcl2 APN 5 76319135 nonsense probably null
IGL02562:Pdcl2 APN 5 76319191 missense probably damaging 1.00
R0288:Pdcl2 UTSW 5 76312497 missense possibly damaging 0.80
R0606:Pdcl2 UTSW 5 76312481 missense probably benign
R2070:Pdcl2 UTSW 5 76324991 critical splice donor site probably null
R6384:Pdcl2 UTSW 5 76331008 splice site probably null
R7414:Pdcl2 UTSW 5 76312512 missense possibly damaging 0.74
R7638:Pdcl2 UTSW 5 76317828 missense probably damaging 1.00
R7688:Pdcl2 UTSW 5 76317923 missense probably benign 0.44
R7718:Pdcl2 UTSW 5 76317999 missense probably damaging 1.00
R7766:Pdcl2 UTSW 5 76317896 missense probably benign 0.00
Z1177:Pdcl2 UTSW 5 76317932 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCATGACAGGAGGACATCAC -3'
(R):5'- CTTTGTTAAAGGTCACAGCACAAGAC -3'

Sequencing Primer
(F):5'- ACCCTGGGCATGAACATTG -3'
(R):5'- GCAAAGATCTATATTGTGCAAAAGAG -3'
Posted On2019-05-13