Incidental Mutation 'R7055:Polg2'
ID547871
Institutional Source Beutler Lab
Gene Symbol Polg2
Ensembl Gene ENSMUSG00000020718
Gene Namepolymerase (DNA directed), gamma 2, accessory subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106768253-106779537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106777214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 216 (F216L)
Ref Sequence ENSEMBL: ENSMUSP00000021060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000127481] [ENSMUST00000133426] [ENSMUST00000134029] [ENSMUST00000155107]
PDB Structure
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021060
AA Change: F216L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718
AA Change: F216L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021062
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133426
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the processivity subunit of the mitochondrial DNA polymerase gamma. The encoded protein forms a heterotrimer containing one catalytic subunit and two processivity subunits. This protein enhances DNA binding and promotes processive DNA synthesis. Mutations in this gene result in autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and turning, fail to initiate turning, lack mt-Co1 activity, and contain abnormal mitochondria with reduced mtDNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Polg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Polg2 APN 11 106777432 splice site probably null
IGL02205:Polg2 APN 11 106779120 missense probably benign 0.09
IGL02850:Polg2 APN 11 106768467 missense probably damaging 1.00
IGL02952:Polg2 APN 11 106772713 missense possibly damaging 0.78
IGL03328:Polg2 APN 11 106768337 missense probably benign 0.40
IGL02835:Polg2 UTSW 11 106775440 missense probably benign
R0109:Polg2 UTSW 11 106777132 splice site probably benign
R0143:Polg2 UTSW 11 106777526 missense probably benign 0.01
R0709:Polg2 UTSW 11 106768413 missense probably damaging 1.00
R1385:Polg2 UTSW 11 106768323 missense probably damaging 0.97
R1938:Polg2 UTSW 11 106778961 missense probably damaging 0.98
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R3159:Polg2 UTSW 11 106768337 missense probably benign 0.40
R3776:Polg2 UTSW 11 106779284 missense probably benign 0.01
R3982:Polg2 UTSW 11 106779202 nonsense probably null
R5306:Polg2 UTSW 11 106778970 missense probably damaging 0.98
R5338:Polg2 UTSW 11 106779238 missense possibly damaging 0.95
R7146:Polg2 UTSW 11 106772746 missense probably benign 0.01
R7464:Polg2 UTSW 11 106773714 missense probably benign 0.08
R7645:Polg2 UTSW 11 106775593 missense probably benign
Z1176:Polg2 UTSW 11 106773429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTAGACATAGGAATCCCC -3'
(R):5'- ACCCAGCAGTGTTACAAGG -3'

Sequencing Primer
(F):5'- CAGCAAGTTCAAGGTCATTCTAGGC -3'
(R):5'- CAGTGTTACAAGGTACAAACTGTGAC -3'
Posted On2019-05-13