Incidental Mutation 'R0612:Gm14085'
ID 54788
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Name predicted gene 14085
Synonyms
MMRRC Submission 038801-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0612 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122484941-122528040 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122521698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 339 (M339T)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect probably damaging
Transcript: ENSMUST00000110521
AA Change: M339T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: M339T

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Meta Mutation Damage Score 0.7686 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 (GRCm38) probably null Het
Abca15 T C 7: 120,337,255 (GRCm38) L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 (GRCm38) I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 (GRCm38) S30G probably benign Het
Atp9b T C 18: 80,753,956 (GRCm38) E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 (GRCm38) L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 (GRCm38) V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 (GRCm38) A112V probably benign Het
Cab39 T C 1: 85,818,515 (GRCm38) probably null Het
Cacna2d4 G T 6: 119,281,718 (GRCm38) probably benign Het
Capzb C T 4: 139,291,029 (GRCm38) S253L probably benign Het
Ccdc174 A G 6: 91,890,892 (GRCm38) probably benign Het
Ccdc180 C T 4: 45,927,969 (GRCm38) A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 (GRCm38) probably benign Het
Cdh8 T C 8: 99,400,914 (GRCm38) T22A probably benign Het
Cdk10 T C 8: 123,230,680 (GRCm38) V181A probably benign Het
Ceacam15 A C 7: 16,673,520 (GRCm38) L24* probably null Het
Cftr A C 6: 18,198,126 (GRCm38) T20P probably benign Het
Clstn3 T C 6: 124,449,500 (GRCm38) T576A probably damaging Het
Col1a2 G A 6: 4,516,003 (GRCm38) V165I unknown Het
Copg2 A T 6: 30,861,469 (GRCm38) probably null Het
Cps1 A G 1: 67,139,770 (GRCm38) H47R probably benign Het
Cytip T C 2: 58,134,190 (GRCm38) D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 (GRCm38) E824K probably damaging Het
Dock7 A C 4: 98,989,233 (GRCm38) V442G probably benign Het
Dsc1 T G 18: 20,114,516 (GRCm38) K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 (GRCm38) P371L probably damaging Het
Enah A G 1: 181,906,448 (GRCm38) probably benign Het
Fam189a1 C T 7: 64,761,801 (GRCm38) V395M probably benign Het
Fastkd1 T C 2: 69,712,383 (GRCm38) T27A probably benign Het
Fcho1 A G 8: 71,715,524 (GRCm38) L248P probably damaging Het
Fezf1 A T 6: 23,247,029 (GRCm38) V268D probably damaging Het
Fgd2 T A 17: 29,378,347 (GRCm38) V547E probably benign Het
Flnb T A 14: 7,887,682 (GRCm38) probably benign Het
Gabrg3 A G 7: 56,729,706 (GRCm38) M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 (GRCm38) F1265L probably damaging Het
Git2 A G 5: 114,752,281 (GRCm38) S271P probably damaging Het
Gm13103 G T 4: 143,852,088 (GRCm38) probably benign Het
Gorab T C 1: 163,397,169 (GRCm38) D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 (GRCm38) T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 (GRCm38) V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 (GRCm38) T149S probably damaging Het
Igsf8 G T 1: 172,319,407 (GRCm38) *108L probably null Het
Il1rap C T 16: 26,701,105 (GRCm38) T307M possibly damaging Het
Itih2 T C 2: 10,117,394 (GRCm38) D232G probably benign Het
Jak3 A G 8: 71,683,377 (GRCm38) Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 (GRCm38) P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 (GRCm38) I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 (GRCm38) L177P probably damaging Het
Map4k3 C A 17: 80,602,193 (GRCm38) K712N probably damaging Het
Med11 A G 11: 70,452,084 (GRCm38) T36A probably benign Het
Mmp14 A G 14: 54,440,434 (GRCm38) D504G probably damaging Het
Mob1a A G 6: 83,334,158 (GRCm38) T120A probably benign Het
Mr1 T A 1: 155,137,690 (GRCm38) D47V probably damaging Het
Nacad G T 11: 6,601,382 (GRCm38) A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 (GRCm38) W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 (GRCm38) T153A probably benign Het
Olfr525 T A 7: 140,323,188 (GRCm38) M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 (GRCm38) T93S probably benign Het
Parp14 G A 16: 35,856,760 (GRCm38) A946V probably benign Het
Pde6c T A 19: 38,133,246 (GRCm38) C101S probably benign Het
Pdia3 G A 2: 121,432,377 (GRCm38) G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 (GRCm38) R16C probably damaging Het
Pet2 G A X: 89,405,366 (GRCm38) R386* probably null Het
Pfkp A G 13: 6,605,634 (GRCm38) probably null Het
Plcg2 T A 8: 117,573,365 (GRCm38) S225T probably benign Het
Pramel1 T C 4: 143,397,531 (GRCm38) S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 (GRCm38) N92D possibly damaging Het
Ric8b C A 10: 85,001,881 (GRCm38) N517K probably damaging Het
Rnf34 G A 5: 122,864,174 (GRCm38) R65H probably damaging Het
Rraga C T 4: 86,576,327 (GRCm38) R137C probably damaging Het
Scube2 C T 7: 109,804,764 (GRCm38) probably benign Het
Spata31d1d T C 13: 59,727,973 (GRCm38) I583V probably benign Het
Suox T C 10: 128,670,656 (GRCm38) E501G probably benign Het
Susd1 A G 4: 59,390,561 (GRCm38) probably benign Het
Tac1 T C 6: 7,555,653 (GRCm38) S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 (GRCm38) E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 (GRCm38) S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 (GRCm38) V662M probably damaging Het
Upf2 G T 2: 6,034,098 (GRCm38) probably benign Het
Uspl1 A G 5: 149,214,957 (GRCm38) E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 (GRCm38) H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 (GRCm38) C367S probably damaging Het
Vps13b A T 15: 35,623,657 (GRCm38) Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 (GRCm38) probably benign Het
Yeats2 T G 16: 20,186,425 (GRCm38) V385G probably benign Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122,517,046 (GRCm38) missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122,524,796 (GRCm38) critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122,517,983 (GRCm38) missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122,525,091 (GRCm38) missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122,514,514 (GRCm38) splice site probably benign
Wilted UTSW 2 122,523,482 (GRCm38) missense probably damaging 1.00
K2124:Gm14085 UTSW 2 122,525,153 (GRCm38) missense probably benign 0.00
R0084:Gm14085 UTSW 2 122,522,833 (GRCm38) missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122,517,597 (GRCm38) splice site probably benign
R0127:Gm14085 UTSW 2 122,517,069 (GRCm38) critical splice donor site probably null
R0200:Gm14085 UTSW 2 122,527,447 (GRCm38) makesense probably null
R0276:Gm14085 UTSW 2 122,521,928 (GRCm38) missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122,517,553 (GRCm38) missense probably benign 0.04
R0403:Gm14085 UTSW 2 122,521,854 (GRCm38) missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122,514,398 (GRCm38) missense probably damaging 0.97
R1676:Gm14085 UTSW 2 122,521,859 (GRCm38) missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122,521,652 (GRCm38) missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122,527,429 (GRCm38) missense probably benign 0.00
R2050:Gm14085 UTSW 2 122,522,868 (GRCm38) missense probably benign 0.21
R3078:Gm14085 UTSW 2 122,514,414 (GRCm38) missense possibly damaging 0.63
R4075:Gm14085 UTSW 2 122,514,411 (GRCm38) missense probably benign 0.00
R4096:Gm14085 UTSW 2 122,522,728 (GRCm38) missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122,522,805 (GRCm38) nonsense probably null
R4796:Gm14085 UTSW 2 122,514,459 (GRCm38) missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122,522,914 (GRCm38) critical splice donor site probably null
R5069:Gm14085 UTSW 2 122,494,373 (GRCm38) missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122,522,778 (GRCm38) missense probably benign 0.01
R5385:Gm14085 UTSW 2 122,522,778 (GRCm38) missense probably benign 0.01
R5386:Gm14085 UTSW 2 122,522,778 (GRCm38) missense probably benign 0.01
R5442:Gm14085 UTSW 2 122,486,869 (GRCm38) missense probably benign
R5795:Gm14085 UTSW 2 122,517,994 (GRCm38) missense possibly damaging 0.79
R6258:Gm14085 UTSW 2 122,523,482 (GRCm38) missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122,523,482 (GRCm38) missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122,524,807 (GRCm38) missense probably benign 0.00
R7226:Gm14085 UTSW 2 122,522,532 (GRCm38) missense probably benign 0.00
R7574:Gm14085 UTSW 2 122,522,844 (GRCm38) missense not run
R7633:Gm14085 UTSW 2 122,486,680 (GRCm38) missense probably null 0.05
R7705:Gm14085 UTSW 2 122,521,629 (GRCm38) critical splice acceptor site probably null
R7726:Gm14085 UTSW 2 122,486,733 (GRCm38) missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122,494,358 (GRCm38) missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122,521,688 (GRCm38) missense probably damaging 1.00
R8337:Gm14085 UTSW 2 122,525,136 (GRCm38) missense probably benign 0.06
R8546:Gm14085 UTSW 2 122,522,754 (GRCm38) missense probably benign 0.14
R8817:Gm14085 UTSW 2 122,518,507 (GRCm38) missense possibly damaging 0.95
R8931:Gm14085 UTSW 2 122,518,502 (GRCm38) missense
R9070:Gm14085 UTSW 2 122,521,673 (GRCm38) missense probably damaging 1.00
R9542:Gm14085 UTSW 2 122,494,341 (GRCm38) missense probably benign 0.26
R9702:Gm14085 UTSW 2 122,523,531 (GRCm38) missense probably damaging 1.00
R9782:Gm14085 UTSW 2 122,521,857 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATCTAGTGTGTGGTCAGCAAG -3'
(R):5'- AGCCATCACTGAGGCAGAAATCAAG -3'

Sequencing Primer
(F):5'- CTCACTAAGTGCATGGATATAGGC -3'
(R):5'- CTGAGGCAGAAATCAAGGATGATG -3'
Posted On 2013-07-11