Incidental Mutation 'R7055:Pros1'
ID547887
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Nameprotein S (alpha)
Synonymsprotein S
MMRRC Submission
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location62854307-62929346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62928102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 646 (V646A)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023629
AA Change: V646A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: V646A

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGCATAGCCTGTTTTC -3'
(R):5'- TGCACGTCACAGGTAACAC -3'

Sequencing Primer
(F):5'- CAGCATAGCCTGTTTTCTGAAC -3'
(R):5'- ACCTGCCAGCTGGTGATAG -3'
Posted On2019-05-13