Incidental Mutation 'R7055:Igf2r'
ID 547889
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR
MMRRC Submission 045152-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R7055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12901293-12988551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12923210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 1200 (Y1200D)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: Y1200D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: Y1200D

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,062,083 (GRCm39) S178P probably damaging Het
2610008E11Rik C T 10: 78,903,681 (GRCm39) E212K probably damaging Het
Abcc4 A T 14: 118,832,197 (GRCm39) L736* probably null Het
Acmsd A T 1: 127,681,570 (GRCm39) M178L probably benign Het
Adpgk T A 9: 59,220,476 (GRCm39) M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 (GRCm39) R149H possibly damaging Het
Aox1 A G 1: 58,338,927 (GRCm39) T307A probably benign Het
C1galt1 T C 6: 7,866,585 (GRCm39) Y144H probably damaging Het
Cabin1 G C 10: 75,579,117 (GRCm39) Q440E probably benign Het
Casq2 A G 3: 102,049,561 (GRCm39) S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Cdan1 A G 2: 120,558,342 (GRCm39) I490T probably damaging Het
Cep170b T A 12: 112,702,149 (GRCm39) V314E probably damaging Het
Col4a4 T C 1: 82,496,757 (GRCm39) E413G unknown Het
Cyp3a25 A C 5: 145,929,801 (GRCm39) F189L probably benign Het
Dido1 T A 2: 180,303,002 (GRCm39) H1634L probably benign Het
Dnaja2 A C 8: 86,275,303 (GRCm39) V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 (GRCm39) probably null Het
Eomes A T 9: 118,309,567 (GRCm39) N240I possibly damaging Het
Fads6 A G 11: 115,176,229 (GRCm39) F199L probably benign Het
Fbrs T C 7: 127,086,956 (GRCm39) probably null Het
Fndc4 T C 5: 31,451,522 (GRCm39) E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,954,775 (GRCm39) probably null Het
Fzr1 T C 10: 81,206,057 (GRCm39) Y210C probably damaging Het
Gjc2 T A 11: 59,067,856 (GRCm39) M209L unknown Het
Gpr33 A G 12: 52,071,036 (GRCm39) M1T probably null Het
Gtf2a1 A T 12: 91,553,523 (GRCm39) I28N possibly damaging Het
Ivd C T 2: 118,703,730 (GRCm39) T212I probably damaging Het
Jag1 A G 2: 136,957,409 (GRCm39) V101A probably benign Het
Kansl3 A T 1: 36,404,701 (GRCm39) V83D possibly damaging Het
Krt81 T A 15: 101,359,006 (GRCm39) I249F probably benign Het
Krtap21-1 G A 16: 89,200,591 (GRCm39) S17L unknown Het
Macf1 A T 4: 123,302,989 (GRCm39) H504Q probably benign Het
Map2 A G 1: 66,455,983 (GRCm39) T1499A probably damaging Het
Map3k9 T C 12: 81,770,982 (GRCm39) T892A probably damaging Het
Mcl1 G A 3: 95,567,110 (GRCm39) V178I probably benign Het
Mrs2 T A 13: 25,188,937 (GRCm39) M126L probably benign Het
Msantd1 C A 5: 35,075,005 (GRCm39) N9K probably benign Het
Myh9 C T 15: 77,659,398 (GRCm39) R116H probably damaging Het
Nfib A T 4: 82,248,662 (GRCm39) D308E probably benign Het
Nme2 T A 11: 93,846,416 (GRCm39) I11F probably damaging Het
Nmnat3 A G 9: 98,292,286 (GRCm39) D111G probably benign Het
Or5d37 T A 2: 87,924,045 (GRCm39) L78F probably damaging Het
Papss2 T C 19: 32,641,827 (GRCm39) W501R probably damaging Het
Parn A G 16: 13,443,998 (GRCm39) I384T possibly damaging Het
Pcdhb18 A G 18: 37,623,864 (GRCm39) D398G possibly damaging Het
Pdcl2 T C 5: 76,465,771 (GRCm39) N102D probably benign Het
Pdzrn3 C A 6: 101,128,735 (GRCm39) E644* probably null Het
Pi4ka T A 16: 17,134,879 (GRCm39) probably benign Het
Polg2 A G 11: 106,668,040 (GRCm39) F216L probably damaging Het
Prkcsh A G 9: 21,924,457 (GRCm39) *522W probably null Het
Prkcz G T 4: 155,374,091 (GRCm39) D108E probably benign Het
Pros1 T C 16: 62,748,465 (GRCm39) V646A possibly damaging Het
Ptprc A G 1: 138,017,309 (GRCm39) I483T probably damaging Het
Rabep2 T C 7: 126,044,485 (GRCm39) I527T possibly damaging Het
Rad50 T C 11: 53,578,929 (GRCm39) K543R probably benign Het
Samd4b A G 7: 28,103,458 (GRCm39) I553T probably benign Het
Sbpl A T 17: 24,172,276 (GRCm39) N214K unknown Het
Scgb2b11 C T 7: 31,909,907 (GRCm39) E60K possibly damaging Het
Sgk3 G A 1: 9,956,284 (GRCm39) E331K probably damaging Het
Snx6 A T 12: 54,830,864 (GRCm39) L32Q probably damaging Het
Srgap3 T A 6: 112,723,924 (GRCm39) Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 (GRCm39) D135G probably damaging Het
Steap4 A G 5: 8,026,858 (GRCm39) T274A probably damaging Het
Svep1 A T 4: 58,064,275 (GRCm39) V3236D probably benign Het
Svep1 A T 4: 58,120,642 (GRCm39) F797Y probably benign Het
Tmem116 T C 5: 121,605,987 (GRCm39) L113P probably damaging Het
Tnfrsf1b A G 4: 144,951,457 (GRCm39) V161A probably damaging Het
Tnpo1 G T 13: 98,991,987 (GRCm39) Q622K possibly damaging Het
Top1mt A G 15: 75,550,523 (GRCm39) V28A probably benign Het
Trim25 T C 11: 88,890,750 (GRCm39) S146P probably benign Het
Tuba3b A G 6: 145,566,935 (GRCm39) D392G possibly damaging Het
Utrn C T 10: 12,623,665 (GRCm39) R191Q probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdfy2 T A 14: 63,137,748 (GRCm39) S84T probably benign Het
Zfp873 T A 10: 81,895,832 (GRCm39) F225I probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,932,877 (GRCm39) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,958,215 (GRCm39) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,919,245 (GRCm39) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,902,754 (GRCm39) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,923,662 (GRCm39) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,914,261 (GRCm39) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,923,236 (GRCm39) missense probably benign
IGL01557:Igf2r APN 17 12,923,522 (GRCm39) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,902,872 (GRCm39) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,944,302 (GRCm39) nonsense probably null
IGL01720:Igf2r APN 17 12,920,200 (GRCm39) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,902,709 (GRCm39) missense probably benign
IGL01839:Igf2r APN 17 12,923,909 (GRCm39) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,933,798 (GRCm39) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,923,225 (GRCm39) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,912,079 (GRCm39) nonsense probably null
IGL02095:Igf2r APN 17 12,920,892 (GRCm39) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,917,403 (GRCm39) unclassified probably benign
IGL02576:Igf2r APN 17 12,967,650 (GRCm39) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,930,974 (GRCm39) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,938,770 (GRCm39) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,911,610 (GRCm39) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,913,007 (GRCm39) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,929,633 (GRCm39) splice site probably benign
IGL03080:Igf2r APN 17 12,945,563 (GRCm39) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,935,559 (GRCm39) missense probably damaging 1.00
blunt UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
brusque UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
gruff UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
outlier UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
NA:Igf2r UTSW 17 12,910,849 (GRCm39) missense probably benign
R0165:Igf2r UTSW 17 12,917,414 (GRCm39) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,902,835 (GRCm39) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,910,951 (GRCm39) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,936,161 (GRCm39) splice site probably null
R0722:Igf2r UTSW 17 12,934,382 (GRCm39) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,910,988 (GRCm39) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,913,011 (GRCm39) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,936,156 (GRCm39) splice site probably benign
R1485:Igf2r UTSW 17 12,910,172 (GRCm39) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,945,196 (GRCm39) missense probably benign
R1693:Igf2r UTSW 17 12,923,203 (GRCm39) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,916,328 (GRCm39) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,923,157 (GRCm39) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,952,790 (GRCm39) nonsense probably null
R1994:Igf2r UTSW 17 12,911,625 (GRCm39) missense probably benign
R2060:Igf2r UTSW 17 12,920,206 (GRCm39) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,917,138 (GRCm39) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,941,095 (GRCm39) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,934,830 (GRCm39) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,941,198 (GRCm39) splice site probably null
R2696:Igf2r UTSW 17 12,914,231 (GRCm39) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,928,355 (GRCm39) missense probably benign
R3930:Igf2r UTSW 17 12,924,716 (GRCm39) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,967,638 (GRCm39) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,921,141 (GRCm39) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,922,352 (GRCm39) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,903,013 (GRCm39) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,920,240 (GRCm39) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,910,764 (GRCm39) splice site probably null
R4980:Igf2r UTSW 17 12,922,247 (GRCm39) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,944,303 (GRCm39) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,912,032 (GRCm39) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,958,221 (GRCm39) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,936,254 (GRCm39) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,917,239 (GRCm39) splice site probably null
R5794:Igf2r UTSW 17 12,928,332 (GRCm39) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,933,000 (GRCm39) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,902,787 (GRCm39) missense probably benign
R6396:Igf2r UTSW 17 12,932,977 (GRCm39) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,920,137 (GRCm39) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6591:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,917,505 (GRCm39) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6691:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,933,831 (GRCm39) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,932,969 (GRCm39) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,922,263 (GRCm39) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,916,228 (GRCm39) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,937,605 (GRCm39) missense probably benign
R7030:Igf2r UTSW 17 12,952,753 (GRCm39) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,917,212 (GRCm39) missense probably benign 0.23
R7074:Igf2r UTSW 17 12,933,003 (GRCm39) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,922,371 (GRCm39) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,917,115 (GRCm39) nonsense probably null
R7463:Igf2r UTSW 17 12,929,532 (GRCm39) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,917,160 (GRCm39) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,954,878 (GRCm39) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,958,256 (GRCm39) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,967,591 (GRCm39) missense probably benign
R8022:Igf2r UTSW 17 12,937,682 (GRCm39) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,920,125 (GRCm39) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,910,958 (GRCm39) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,952,747 (GRCm39) missense probably benign
R8359:Igf2r UTSW 17 12,902,748 (GRCm39) missense probably benign
R8500:Igf2r UTSW 17 12,928,328 (GRCm39) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,923,200 (GRCm39) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,923,524 (GRCm39) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,920,131 (GRCm39) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,945,659 (GRCm39) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,935,537 (GRCm39) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,970,180 (GRCm39) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,910,100 (GRCm39) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,958,238 (GRCm39) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,914,240 (GRCm39) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,924,646 (GRCm39) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,917,215 (GRCm39) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,905,641 (GRCm39) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,913,027 (GRCm39) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,945,588 (GRCm39) missense probably benign
X0028:Igf2r UTSW 17 12,923,800 (GRCm39) nonsense probably null
Z1177:Igf2r UTSW 17 12,916,286 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGGCTTAATAAAGACCTCAAGG -3'
(R):5'- GGGCATTGCTAGTGTCTGAC -3'

Sequencing Primer
(F):5'- CCTCAAGGATAAGGGGTGACC -3'
(R):5'- ACTAGAGTATACTGTTTTCCTCAGGC -3'
Posted On 2019-05-13