Incidental Mutation 'R7055:Vmn2r111'
ID 547890
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 045152-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22778032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,062,083 (GRCm39) S178P probably damaging Het
2610008E11Rik C T 10: 78,903,681 (GRCm39) E212K probably damaging Het
Abcc4 A T 14: 118,832,197 (GRCm39) L736* probably null Het
Acmsd A T 1: 127,681,570 (GRCm39) M178L probably benign Het
Adpgk T A 9: 59,220,476 (GRCm39) M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 (GRCm39) R149H possibly damaging Het
Aox1 A G 1: 58,338,927 (GRCm39) T307A probably benign Het
C1galt1 T C 6: 7,866,585 (GRCm39) Y144H probably damaging Het
Cabin1 G C 10: 75,579,117 (GRCm39) Q440E probably benign Het
Casq2 A G 3: 102,049,561 (GRCm39) S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Cdan1 A G 2: 120,558,342 (GRCm39) I490T probably damaging Het
Cep170b T A 12: 112,702,149 (GRCm39) V314E probably damaging Het
Col4a4 T C 1: 82,496,757 (GRCm39) E413G unknown Het
Cyp3a25 A C 5: 145,929,801 (GRCm39) F189L probably benign Het
Dido1 T A 2: 180,303,002 (GRCm39) H1634L probably benign Het
Dnaja2 A C 8: 86,275,303 (GRCm39) V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 (GRCm39) probably null Het
Eomes A T 9: 118,309,567 (GRCm39) N240I possibly damaging Het
Fads6 A G 11: 115,176,229 (GRCm39) F199L probably benign Het
Fbrs T C 7: 127,086,956 (GRCm39) probably null Het
Fndc4 T C 5: 31,451,522 (GRCm39) E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,954,775 (GRCm39) probably null Het
Fzr1 T C 10: 81,206,057 (GRCm39) Y210C probably damaging Het
Gjc2 T A 11: 59,067,856 (GRCm39) M209L unknown Het
Gpr33 A G 12: 52,071,036 (GRCm39) M1T probably null Het
Gtf2a1 A T 12: 91,553,523 (GRCm39) I28N possibly damaging Het
Igf2r A C 17: 12,923,210 (GRCm39) Y1200D probably damaging Het
Ivd C T 2: 118,703,730 (GRCm39) T212I probably damaging Het
Jag1 A G 2: 136,957,409 (GRCm39) V101A probably benign Het
Kansl3 A T 1: 36,404,701 (GRCm39) V83D possibly damaging Het
Krt81 T A 15: 101,359,006 (GRCm39) I249F probably benign Het
Krtap21-1 G A 16: 89,200,591 (GRCm39) S17L unknown Het
Macf1 A T 4: 123,302,989 (GRCm39) H504Q probably benign Het
Map2 A G 1: 66,455,983 (GRCm39) T1499A probably damaging Het
Map3k9 T C 12: 81,770,982 (GRCm39) T892A probably damaging Het
Mcl1 G A 3: 95,567,110 (GRCm39) V178I probably benign Het
Mrs2 T A 13: 25,188,937 (GRCm39) M126L probably benign Het
Msantd1 C A 5: 35,075,005 (GRCm39) N9K probably benign Het
Myh9 C T 15: 77,659,398 (GRCm39) R116H probably damaging Het
Nfib A T 4: 82,248,662 (GRCm39) D308E probably benign Het
Nme2 T A 11: 93,846,416 (GRCm39) I11F probably damaging Het
Nmnat3 A G 9: 98,292,286 (GRCm39) D111G probably benign Het
Or5d37 T A 2: 87,924,045 (GRCm39) L78F probably damaging Het
Papss2 T C 19: 32,641,827 (GRCm39) W501R probably damaging Het
Parn A G 16: 13,443,998 (GRCm39) I384T possibly damaging Het
Pcdhb18 A G 18: 37,623,864 (GRCm39) D398G possibly damaging Het
Pdcl2 T C 5: 76,465,771 (GRCm39) N102D probably benign Het
Pdzrn3 C A 6: 101,128,735 (GRCm39) E644* probably null Het
Pi4ka T A 16: 17,134,879 (GRCm39) probably benign Het
Polg2 A G 11: 106,668,040 (GRCm39) F216L probably damaging Het
Prkcsh A G 9: 21,924,457 (GRCm39) *522W probably null Het
Prkcz G T 4: 155,374,091 (GRCm39) D108E probably benign Het
Pros1 T C 16: 62,748,465 (GRCm39) V646A possibly damaging Het
Ptprc A G 1: 138,017,309 (GRCm39) I483T probably damaging Het
Rabep2 T C 7: 126,044,485 (GRCm39) I527T possibly damaging Het
Rad50 T C 11: 53,578,929 (GRCm39) K543R probably benign Het
Samd4b A G 7: 28,103,458 (GRCm39) I553T probably benign Het
Sbpl A T 17: 24,172,276 (GRCm39) N214K unknown Het
Scgb2b11 C T 7: 31,909,907 (GRCm39) E60K possibly damaging Het
Sgk3 G A 1: 9,956,284 (GRCm39) E331K probably damaging Het
Snx6 A T 12: 54,830,864 (GRCm39) L32Q probably damaging Het
Srgap3 T A 6: 112,723,924 (GRCm39) Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 (GRCm39) D135G probably damaging Het
Steap4 A G 5: 8,026,858 (GRCm39) T274A probably damaging Het
Svep1 A T 4: 58,064,275 (GRCm39) V3236D probably benign Het
Svep1 A T 4: 58,120,642 (GRCm39) F797Y probably benign Het
Tmem116 T C 5: 121,605,987 (GRCm39) L113P probably damaging Het
Tnfrsf1b A G 4: 144,951,457 (GRCm39) V161A probably damaging Het
Tnpo1 G T 13: 98,991,987 (GRCm39) Q622K possibly damaging Het
Top1mt A G 15: 75,550,523 (GRCm39) V28A probably benign Het
Trim25 T C 11: 88,890,750 (GRCm39) S146P probably benign Het
Tuba3b A G 6: 145,566,935 (GRCm39) D392G possibly damaging Het
Utrn C T 10: 12,623,665 (GRCm39) R191Q probably benign Het
Wdfy2 T A 14: 63,137,748 (GRCm39) S84T probably benign Het
Zfp873 T A 10: 81,895,832 (GRCm39) F225I probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2019-05-13