Mutagenetix > Incidental Mutation

Incidental Mutation 'R7055:Vmn2r111'

547890

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7055 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,226,221	S178P	probably damaging	Het
2610008E11Rik	C	T	10: 79,067,847	E212K	probably damaging	Het
Abcc4	A	T	14: 118,594,785	L736*	probably null	Het
Acmsd	A	T	1: 127,753,833	M178L	probably benign	Het
Adpgk	T	A	9: 59,313,193	M266K	possibly damaging	Het
Aldh1b1	G	A	4: 45,802,909	R149H	possibly damaging	Het
Aox2	A	G	1: 58,299,768	T307A	probably benign	Het
C1galt1	T	C	6: 7,866,585	Y144H	probably damaging	Het
Cabin1	G	C	10: 75,743,283	Q440E	probably benign	Het
Casq2	A	G	3: 102,142,245	S231G	probably damaging	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Cdan1	A	G	2: 120,727,861	I490T	probably damaging	Het
Cep170b	T	A	12: 112,735,715	V314E	probably damaging	Het
Col4a4	T	C	1: 82,519,036	E413G	unknown	Het
Cyp3a25	A	C	5: 145,992,991	F189L	probably benign	Het
Dido1	T	A	2: 180,661,209	H1634L	probably benign	Het
Dnaja2	A	C	8: 85,548,674	V156G	probably benign	Het
Dpy19l4	T	C	4: 11,290,291		probably null	Het
Eomes	A	T	9: 118,480,499	N240I	possibly damaging	Het
Fads6	A	G	11: 115,285,403	F199L	probably benign	Het
Fbrs	T	C	7: 127,487,784		probably null	Het
Fndc4	T	C	5: 31,294,178	E153G	probably benign	Het
Fv1	TTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTC	4: 147,870,318		probably null	Het
Fzr1	T	C	10: 81,370,223	Y210C	probably damaging	Het
Gjc2	T	A	11: 59,177,030	M209L	unknown	Het
Gpr33	A	G	12: 52,024,253	M1T	probably null	Het
Gtf2a1	A	T	12: 91,586,749	I28N	possibly damaging	Het
Igf2r	A	C	17: 12,704,323	Y1200D	probably damaging	Het
Ivd	C	T	2: 118,873,249	T212I	probably damaging	Het
Jag1	A	G	2: 137,115,489	V101A	probably benign	Het
Kansl3	A	T	1: 36,365,620	V83D	possibly damaging	Het
Krt81	T	A	15: 101,461,125	I249F	probably benign	Het
Krtap21-1	G	A	16: 89,403,703	S17L	unknown	Het
Macf1	A	T	4: 123,409,196	H504Q	probably benign	Het
Map2	A	G	1: 66,416,824	T1499A	probably damaging	Het
Map3k9	T	C	12: 81,724,208	T892A	probably damaging	Het
Mcl1	G	A	3: 95,659,799	V178I	probably benign	Het
Mrs2	T	A	13: 25,004,954	M126L	probably benign	Het
Msantd1	C	A	5: 34,917,661	N9K	probably benign	Het
Myh9	C	T	15: 77,775,198	R116H	probably damaging	Het
Nfib	A	T	4: 82,330,425	D308E	probably benign	Het
Nme2	T	A	11: 93,955,590	I11F	probably damaging	Het
Nmnat3	A	G	9: 98,410,233	D111G	probably benign	Het
Olfr1164	T	A	2: 88,093,701	L78F	probably damaging	Het
Papss2	T	C	19: 32,664,427	W501R	probably damaging	Het
Parn	A	G	16: 13,626,134	I384T	possibly damaging	Het
Pcdhb18	A	G	18: 37,490,811	D398G	possibly damaging	Het
Pdcl2	T	C	5: 76,317,924	N102D	probably benign	Het
Pdzrn3	C	A	6: 101,151,774	E644*	probably null	Het
Pi4ka	T	A	16: 17,317,015		probably benign	Het
Polg2	A	G	11: 106,777,214	F216L	probably damaging	Het
Prkcsh	A	G	9: 22,013,161	*522W	probably null	Het
Prkcz	G	T	4: 155,289,634	D108E	probably benign	Het
Pros1	T	C	16: 62,928,102	V646A	possibly damaging	Het
Ptprc	A	G	1: 138,089,571	I483T	probably damaging	Het
Rabep2	T	C	7: 126,445,313	I527T	possibly damaging	Het
Rad50	T	C	11: 53,688,102	K543R	probably benign	Het
Samd4b	A	G	7: 28,404,033	I553T	probably benign	Het
Sbpl	A	T	17: 23,953,302	N214K	unknown	Het
Scgb2b11	C	T	7: 32,210,482	E60K	possibly damaging	Het
Sgk3	G	A	1: 9,886,059	E331K	probably damaging	Het
Snx6	A	T	12: 54,784,079	L32Q	probably damaging	Het
Srgap3	T	A	6: 112,746,963	Q512L	probably damaging	Het
Srsf12	A	G	4: 33,226,157	D135G	probably damaging	Het
Steap4	A	G	5: 7,976,858	T274A	probably damaging	Het
Svep1	A	T	4: 58,064,275	V3236D	probably benign	Het
Svep1	A	T	4: 58,120,642	F797Y	probably benign	Het
Tmem116	T	C	5: 121,467,924	L113P	probably damaging	Het
Tnfrsf1b	A	G	4: 145,224,887	V161A	probably damaging	Het
Tnpo1	G	T	13: 98,855,479	Q622K	possibly damaging	Het
Top1mt	A	G	15: 75,678,674	V28A	probably benign	Het
Trim25	T	C	11: 88,999,924	S146P	probably benign	Het
Tuba3b	A	G	6: 145,621,209	D392G	possibly damaging	Het
Utrn	C	T	10: 12,747,921	R191Q	probably benign	Het
Wdfy2	T	A	14: 62,900,299	S84T	probably benign	Het
Zfp873	T	A	10: 82,059,998	F225I	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2019-05-13