Incidental Mutation 'R7055:Papss2'
ID547893
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32664427 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 501 (W501R)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably damaging
Transcript: ENSMUST00000025833
AA Change: W501R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: W501R

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 splice site probably null
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R7991:Papss2 UTSW 19 32652003 missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGTCTTATCCAATATAACCCAGCTTG -3'
(R):5'- CCAGAAACCTACCTTGCTGGATC -3'

Sequencing Primer
(F):5'- ACCCAGCTTGAATAGTGCTAG -3'
(R):5'- TTATTGTAGGCAGCCACTCGGAAC -3'
Posted On2019-05-13