Incidental Mutation 'R7056:Zfp69'
ID547907
Institutional Source Beutler Lab
Gene Symbol Zfp69
Ensembl Gene ENSMUSG00000064141
Gene Namezinc finger protein 69
SynonymsZfp63, LOC381549, KRAB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7056 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location120930137-120951699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120931098 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 340 (V340A)
Ref Sequence ENSEMBL: ENSMUSP00000101888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106280] [ENSMUST00000106281] [ENSMUST00000130702]
Predicted Effect probably benign
Transcript: ENSMUST00000106280
AA Change: V340A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101887
Gene: ENSMUSG00000064141
AA Change: V340A

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106281
AA Change: V340A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101888
Gene: ENSMUSG00000064141
AA Change: V340A

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130702
SMART Domains Protein: ENSMUSP00000133312
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
KRAB 1 32 2.6e-2 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Cep97 A G 16: 55,905,572 S651P probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Cog5 T C 12: 31,665,469 V80A possibly damaging Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dennd4a A G 9: 64,906,923 D1474G possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Sh3pxd2b T C 11: 32,422,737 S635P probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Zfp69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Zfp69 APN 4 120931500 missense probably damaging 1.00
IGL02604:Zfp69 APN 4 120931463 missense probably benign 0.10
IGL03406:Zfp69 APN 4 120931084 missense probably benign
R0505:Zfp69 UTSW 4 120931095 missense probably damaging 1.00
R0613:Zfp69 UTSW 4 120934347 missense probably benign
R0628:Zfp69 UTSW 4 120949425 nonsense probably null
R0838:Zfp69 UTSW 4 120931281 missense probably benign 0.09
R1669:Zfp69 UTSW 4 120947498 utr 5 prime probably benign
R2060:Zfp69 UTSW 4 120930832 missense probably damaging 0.98
R3740:Zfp69 UTSW 4 120930874 splice site probably null
R4242:Zfp69 UTSW 4 120934475 intron probably benign
R4770:Zfp69 UTSW 4 120934417 missense probably damaging 0.99
R4998:Zfp69 UTSW 4 120947325 missense possibly damaging 0.52
R5620:Zfp69 UTSW 4 120930522 missense probably damaging 1.00
R6312:Zfp69 UTSW 4 120949517 unclassified probably benign
R6534:Zfp69 UTSW 4 120931197 missense probably benign 0.05
R7061:Zfp69 UTSW 4 120931401 missense possibly damaging 0.69
R7663:Zfp69 UTSW 4 120935126 missense probably benign 0.17
R8169:Zfp69 UTSW 4 120930534 missense probably damaging 1.00
R8348:Zfp69 UTSW 4 120930637 missense probably damaging 1.00
R8389:Zfp69 UTSW 4 120949352 missense possibly damaging 0.93
RF053:Zfp69 UTSW 4 120947347 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTGTATCCTCTGCCTGAAGG -3'
(R):5'- TGGAAAACCCAGAGAGTTCC -3'

Sequencing Primer
(F):5'- CATTTGTCACACGTGAACGG -3'
(R):5'- CCCAGAGAGTTCCAATGTTATTTTAG -3'
Posted On2019-05-13