Incidental Mutation 'R7056:Pyroxd1'
ID547919
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7056 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142345654-142363257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142359082 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 345 (R345L)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041852
AA Change: R345L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: R345L

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111803
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect probably benign
Transcript: ENSMUST00000123912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154870
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Cep97 A G 16: 55,905,572 S651P probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Cog5 T C 12: 31,665,469 V80A possibly damaging Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dennd4a A G 9: 64,906,923 D1474G possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Sh3pxd2b T C 11: 32,422,737 S635P probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zfp69 A G 4: 120,931,098 V340A probably benign Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R1319:Pyroxd1 UTSW 6 142359148 missense probably benign 0.33
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4638:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4642:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4643:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5359:Pyroxd1 UTSW 6 142361991 missense probably damaging 1.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
R8925:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
R8927:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTCAGTAGGAGTCTGGCC -3'
(R):5'- AAATTGGCTCCAGTGGCTTC -3'

Sequencing Primer
(F):5'- TAGGAGTCTGGCCAGGGG -3'
(R):5'- GGCTCCAGTGGCTTCAATTTAAAG -3'
Posted On2019-05-13