Incidental Mutation 'R7056:Dennd4a'
ID547928
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7056 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64906923 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1474 (D1474G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: D1474G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: D1474G

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Cep97 A G 16: 55,905,572 S651P probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Cog5 T C 12: 31,665,469 V80A possibly damaging Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Sh3pxd2b T C 11: 32,422,737 S635P probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zfp69 A G 4: 120,931,098 V340A probably benign Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64906920 missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8397:Dennd4a UTSW 9 64889109 missense probably benign
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATGGAGTCTTTGTTACTAC -3'
(R):5'- CTTGTCCGACTTGCAAAGTGC -3'

Sequencing Primer
(F):5'- ACTACGGTGTGTTTTCCTTTGTAATC -3'
(R):5'- GATGAGCTGGACTTCAAGAAATATC -3'
Posted On2019-05-13