Incidental Mutation 'R7056:Sh3pxd2b'
ID547934
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R7056 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32422737 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 635 (S635P)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect probably benign
Transcript: ENSMUST00000038753
AA Change: S635P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: S635P

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Cep97 A G 16: 55,905,572 S651P probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Cog5 T C 12: 31,665,469 V80A possibly damaging Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dennd4a A G 9: 64,906,923 D1474G possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zfp69 A G 4: 120,931,098 V340A probably benign Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7131:Sh3pxd2b UTSW 11 32422072 missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32414318 missense probably damaging 1.00
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTTGACAAGAGCAAGTTCC -3'
(R):5'- GTGTCTCCTTTGGACTCAGC -3'

Sequencing Primer
(F):5'- TTCCCGCTGAGAAATGACATG -3'
(R):5'- AGACCTGTCCTGGCCATG -3'
Posted On2019-05-13