Mutagenetix > Incidental Mutation

Incidental Mutation 'R7056:Cog5'

547940

Institutional Source

Beutler Lab

Gene Symbol

Cog5

Ensembl Gene

ENSMUSG00000035933

Gene Name

component of oligomeric golgi complex 5

Synonyms

5430405C01Rik, GOLTC1, GTC90

MMRRC Submission

Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene?

Probably essential (E-score: 0.879) question?

Stock #

R7056 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31654869-31937630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31665469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 80 (V80A)

Ref Sequence

ENSEMBL: ENSMUSP00000044797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036862]

AlphaFold

Q8C0L8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036862
AA Change: V80A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: V80A

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
Pfam:COG5	35	158	3.8e-37	PFAM
Pfam:Vps51	37	120	1.8e-12	PFAM

Meta Mutation Damage Score

0.1443

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]

Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atr	T	A	9: 95,862,863	S78T	probably damaging	Het
B2m	T	C	2: 122,150,984	L60P	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cep350	A	C	1: 155,848,627	I3075S	probably damaging	Het
Cep97	A	G	16: 55,905,572	S651P	probably damaging	Het
Chrna5	C	T	9: 54,981,701		probably benign	Het
Col9a2	G	A	4: 121,049,716		probably null	Het
Cop1	C	T	1: 159,250,077	L161F	probably damaging	Het
Cyp4f17	A	T	17: 32,527,872	M383L	possibly damaging	Het
Dennd4a	A	G	9: 64,906,923	D1474G	possibly damaging	Het
Dgkb	A	C	12: 38,100,493	S100R	probably benign	Het
Dnah17	A	G	11: 118,125,386	V309A	probably benign	Het
Dner	C	A	1: 84,580,736	R169L	possibly damaging	Het
Dus1l	T	C	11: 120,791,294	E362G	probably benign	Het
Eed	A	T	7: 89,970,356	S168T	possibly damaging	Het
Eif3a	T	A	19: 60,763,062		probably null	Het
Fam234b	A	G	6: 135,228,452	S472G	probably benign	Het
Fbn2	T	A	18: 58,076,726	T1028S	probably benign	Het
Fbxw16	A	G	9: 109,436,284	V393A	possibly damaging	Het
Fig4	A	T	10: 41,220,932	L838Q	probably benign	Het
Gm13941	T	G	2: 111,096,802	S137R	unknown	Het
Gm9938	T	G	19: 23,724,617		probably benign	Het
Igsf10	T	G	3: 59,331,080	D560A	probably damaging	Het
Lrrk2	T	A	15: 91,774,995	L1870*	probably null	Het
Mep1b	T	A	18: 21,091,190	Y347N	probably damaging	Het
Mepce	T	C	5: 137,782,706	N613D	probably damaging	Het
Mgat3	T	G	15: 80,211,896	L308R	probably damaging	Het
Morc2a	A	G	11: 3,675,925	Y175C	probably damaging	Het
Necab2	A	G	8: 119,452,139	N98S	probably benign	Het
Net1	T	C	13: 3,884,845	M394V	probably benign	Het
Nfat5	G	A	8: 107,368,106	G993D	probably damaging	Het
Obscn	C	A	11: 58,996,296		probably benign	Het
Olfr1313	T	C	2: 112,072,317	N89D	probably benign	Het
Olfr324	A	G	11: 58,598,218	Y274C	probably damaging	Het
Olr1	T	C	6: 129,488,941	H34R	probably damaging	Het
Pmm2	T	A	16: 8,642,764	F27L	probably damaging	Het
Ptpdc1	C	A	13: 48,586,990	V261F	possibly damaging	Het
Pyroxd1	G	T	6: 142,359,082	R345L	probably benign	Het
Radil	A	T	5: 142,494,354	C670*	probably null	Het
Rasgrf2	C	T	13: 92,030,695	S290N	probably damaging	Het
Rbm33	T	C	5: 28,394,003		probably benign	Het
Rnf111	A	T	9: 70,453,675	S501R	possibly damaging	Het
Sel1l2	T	A	2: 140,245,414	I446F	probably benign	Het
Sh3pxd2b	T	C	11: 32,422,737	S635P	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Smg1	T	C	7: 118,146,400		probably benign	Het
Sorcs2	C	A	5: 36,068,130	D132Y	probably damaging	Het
Sox18	T	C	2: 181,671,487	D12G	probably damaging	Het
Srsf4	G	T	4: 131,900,693		probably benign	Het
Susd4	C	A	1: 182,833,156	T81N	probably benign	Het
Tmem256	G	T	11: 69,838,590		probably benign	Het
Tor4a	T	C	2: 25,194,841	H350R	probably benign	Het
Ugt2a3	T	A	5: 87,337,094	S24C	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r77	C	T	7: 86,801,815	T303I	probably benign	Het
Wdr70	T	A	15: 7,884,396	I591F	possibly damaging	Het
Wdr93	T	C	7: 79,749,340	I74T	probably damaging	Het
Zfp292	A	T	4: 34,809,784	C1087S	probably damaging	Het
Zfp592	T	A	7: 81,023,319	D10E	probably damaging	Het
Zfp69	A	G	4: 120,931,098	V340A	probably benign	Het
Zswim2	C	T	2: 83,920,748		probably null	Het

Other mutations in Cog5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cog5	APN	12	31685704	missense	probably damaging	1.00
IGL00495:Cog5	APN	12	31837309	missense	probably benign	0.06
IGL00763:Cog5	APN	12	31665532	splice site	probably benign
IGL00789:Cog5	APN	12	31760952	missense	possibly damaging	0.95
IGL01288:Cog5	APN	12	31886206	missense	probably benign	0.13
IGL01315:Cog5	APN	12	31760986	splice site	probably benign
IGL01396:Cog5	APN	12	31894096	missense	probably benign	0.01
IGL02468:Cog5	APN	12	31837358	critical splice donor site	probably null
IGL03030:Cog5	APN	12	31790922	missense	probably damaging	0.99
IGL03346:Cog5	APN	12	31894038	missense	possibly damaging	0.88
R0201:Cog5	UTSW	12	31839841	missense	probably damaging	0.99
R0356:Cog5	UTSW	12	31837181	splice site	probably benign
R0492:Cog5	UTSW	12	31869461	missense	probably damaging	1.00
R0646:Cog5	UTSW	12	31837359	splice site	probably benign
R0971:Cog5	UTSW	12	31919678	missense	probably benign	0.11
R1158:Cog5	UTSW	12	31870057	splice site	probably benign
R1997:Cog5	UTSW	12	31660849	missense	possibly damaging	0.66
R2167:Cog5	UTSW	12	31837289	missense	probably damaging	0.99
R4414:Cog5	UTSW	12	31660854	nonsense	probably null
R4755:Cog5	UTSW	12	31869406	splice site	probably null
R4836:Cog5	UTSW	12	31919733	missense	probably benign	0.07
R5017:Cog5	UTSW	12	31920605	missense	probably benign	0.29
R5256:Cog5	UTSW	12	31886205	missense	probably benign
R5986:Cog5	UTSW	12	31660717	missense	probably benign	0.03
R6131:Cog5	UTSW	12	31886221	missense	possibly damaging	0.47
R6885:Cog5	UTSW	12	31894199	missense	probably damaging	1.00
R7177:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R7182:Cog5	UTSW	12	31685708	missense	probably damaging	1.00
R7418:Cog5	UTSW	12	31833241	missense	probably damaging	1.00
R7445:Cog5	UTSW	12	31919672	missense	possibly damaging	0.64
R7585:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R8332:Cog5	UTSW	12	31833223	nonsense	probably null
R8722:Cog5	UTSW	12	31919704	missense	possibly damaging	0.82
R8781:Cog5	UTSW	12	31833250	missense	probably damaging	1.00
R8911:Cog5	UTSW	12	31833239	missense	probably damaging	1.00
R8979:Cog5	UTSW	12	31790895	missense	probably benign	0.00
R9153:Cog5	UTSW	12	31660811	missense	possibly damaging	0.87
X0062:Cog5	UTSW	12	31685692	missense	probably benign	0.01
Z1177:Cog5	UTSW	12	31801985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTAGCACTATACACTTTTGCTCTG -3'
(R):5'- ACAGCACAGTCTGTATGGCC -3'

Sequencing Primer
(F):5'- GCACTATACACTTTTGCTCTGTATTG -3'
(R):5'- GTCTGTATGGCCCACACAATC -3'

Posted On

2019-05-13