Incidental Mutation 'R7056:Cog5'
ID 547940
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Name component of oligomeric golgi complex 5
Synonyms 5430405C01Rik, GOLTC1, GTC90
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock # R7056 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 31654869-31937630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31665469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
AlphaFold Q8C0L8
Predicted Effect possibly damaging
Transcript: ENSMUST00000036862
AA Change: V80A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: V80A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Meta Mutation Damage Score 0.1443 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Cep97 A G 16: 55,905,572 S651P probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dennd4a A G 9: 64,906,923 D1474G possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Sh3pxd2b T C 11: 32,422,737 S635P probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zfp69 A G 4: 120,931,098 V340A probably benign Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0356:Cog5 UTSW 12 31837181 splice site probably benign
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R0971:Cog5 UTSW 12 31919678 missense probably benign 0.11
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31837289 missense probably damaging 0.99
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5017:Cog5 UTSW 12 31920605 missense probably benign 0.29
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R8332:Cog5 UTSW 12 31833223 nonsense probably null
R8722:Cog5 UTSW 12 31919704 missense possibly damaging 0.82
R8781:Cog5 UTSW 12 31833250 missense probably damaging 1.00
R8911:Cog5 UTSW 12 31833239 missense probably damaging 1.00
R8979:Cog5 UTSW 12 31790895 missense probably benign 0.00
R9153:Cog5 UTSW 12 31660811 missense possibly damaging 0.87
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Z1177:Cog5 UTSW 12 31801985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAGCACTATACACTTTTGCTCTG -3'
(R):5'- ACAGCACAGTCTGTATGGCC -3'

Sequencing Primer
(F):5'- GCACTATACACTTTTGCTCTGTATTG -3'
(R):5'- GTCTGTATGGCCCACACAATC -3'
Posted On 2019-05-13