Incidental Mutation 'R7056:Cep97'
ID547949
Institutional Source Beutler Lab
Gene Symbol Cep97
Ensembl Gene ENSMUSG00000022604
Gene Namecentrosomal protein 97
Synonyms4932439K18Rik, E130116N02Rik, Lrriq2, 2810403B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7056 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location55899888-55934855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55905572 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 651 (S651P)
Ref Sequence ENSEMBL: ENSMUSP00000112663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023270] [ENSMUST00000117468] [ENSMUST00000118500]
Predicted Effect probably damaging
Transcript: ENSMUST00000023270
AA Change: S723P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023270
Gene: ENSMUSG00000022604
AA Change: S723P

DomainStartEndE-ValueType
Pfam:LRR_9 98 259 1.8e-12 PFAM
IQ 549 571 2e-1 SMART
coiled coil region 576 609 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117468
AA Change: S651P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112687
Gene: ENSMUSG00000022604
AA Change: S651P

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118500
AA Change: S651P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112663
Gene: ENSMUSG00000022604
AA Change: S651P

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T A 9: 95,862,863 S78T probably damaging Het
B2m T C 2: 122,150,984 L60P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cep350 A C 1: 155,848,627 I3075S probably damaging Het
Chrna5 C T 9: 54,981,701 probably benign Het
Cog5 T C 12: 31,665,469 V80A possibly damaging Het
Col9a2 G A 4: 121,049,716 probably null Het
Cop1 C T 1: 159,250,077 L161F probably damaging Het
Cyp4f17 A T 17: 32,527,872 M383L possibly damaging Het
Dennd4a A G 9: 64,906,923 D1474G possibly damaging Het
Dgkb A C 12: 38,100,493 S100R probably benign Het
Dnah17 A G 11: 118,125,386 V309A probably benign Het
Dner C A 1: 84,580,736 R169L possibly damaging Het
Dus1l T C 11: 120,791,294 E362G probably benign Het
Eed A T 7: 89,970,356 S168T possibly damaging Het
Eif3a T A 19: 60,763,062 probably null Het
Fam234b A G 6: 135,228,452 S472G probably benign Het
Fbn2 T A 18: 58,076,726 T1028S probably benign Het
Fbxw16 A G 9: 109,436,284 V393A possibly damaging Het
Fig4 A T 10: 41,220,932 L838Q probably benign Het
Gm13941 T G 2: 111,096,802 S137R unknown Het
Gm9938 T G 19: 23,724,617 probably benign Het
Igsf10 T G 3: 59,331,080 D560A probably damaging Het
Lrrk2 T A 15: 91,774,995 L1870* probably null Het
Mep1b T A 18: 21,091,190 Y347N probably damaging Het
Mepce T C 5: 137,782,706 N613D probably damaging Het
Mgat3 T G 15: 80,211,896 L308R probably damaging Het
Morc2a A G 11: 3,675,925 Y175C probably damaging Het
Necab2 A G 8: 119,452,139 N98S probably benign Het
Net1 T C 13: 3,884,845 M394V probably benign Het
Nfat5 G A 8: 107,368,106 G993D probably damaging Het
Obscn C A 11: 58,996,296 probably benign Het
Olfr1313 T C 2: 112,072,317 N89D probably benign Het
Olfr324 A G 11: 58,598,218 Y274C probably damaging Het
Olr1 T C 6: 129,488,941 H34R probably damaging Het
Pmm2 T A 16: 8,642,764 F27L probably damaging Het
Ptpdc1 C A 13: 48,586,990 V261F possibly damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Radil A T 5: 142,494,354 C670* probably null Het
Rasgrf2 C T 13: 92,030,695 S290N probably damaging Het
Rbm33 T C 5: 28,394,003 probably benign Het
Rnf111 A T 9: 70,453,675 S501R possibly damaging Het
Sel1l2 T A 2: 140,245,414 I446F probably benign Het
Sh3pxd2b T C 11: 32,422,737 S635P probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Smg1 T C 7: 118,146,400 probably benign Het
Sorcs2 C A 5: 36,068,130 D132Y probably damaging Het
Sox18 T C 2: 181,671,487 D12G probably damaging Het
Srsf4 G T 4: 131,900,693 probably benign Het
Susd4 C A 1: 182,833,156 T81N probably benign Het
Tmem256 G T 11: 69,838,590 probably benign Het
Tor4a T C 2: 25,194,841 H350R probably benign Het
Ugt2a3 T A 5: 87,337,094 S24C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r77 C T 7: 86,801,815 T303I probably benign Het
Wdr70 T A 15: 7,884,396 I591F possibly damaging Het
Wdr93 T C 7: 79,749,340 I74T probably damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp592 T A 7: 81,023,319 D10E probably damaging Het
Zfp69 A G 4: 120,931,098 V340A probably benign Het
Zswim2 C T 2: 83,920,748 probably null Het
Other mutations in Cep97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Cep97 APN 16 55924960 splice site probably benign
IGL01142:Cep97 APN 16 55922198 missense probably damaging 1.00
IGL01383:Cep97 APN 16 55911607 missense probably damaging 1.00
IGL01529:Cep97 APN 16 55930618 splice site probably benign
IGL01693:Cep97 APN 16 55930594 missense probably damaging 1.00
IGL01759:Cep97 APN 16 55930573 missense probably damaging 1.00
IGL02085:Cep97 APN 16 55915505 missense probably damaging 1.00
IGL02135:Cep97 APN 16 55922967 missense probably damaging 1.00
IGL02582:Cep97 APN 16 55922176 missense probably damaging 1.00
IGL02631:Cep97 APN 16 55922178 nonsense probably null
IGL02899:Cep97 APN 16 55918540 missense probably damaging 0.98
IGL03086:Cep97 APN 16 55915296 missense probably benign
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0309:Cep97 UTSW 16 55925058 missense probably damaging 0.96
R0504:Cep97 UTSW 16 55905779 missense probably benign 0.00
R0507:Cep97 UTSW 16 55905882 splice site probably benign
R0508:Cep97 UTSW 16 55930606 missense probably benign 0.02
R0658:Cep97 UTSW 16 55914902 missense probably benign 0.09
R1588:Cep97 UTSW 16 55927821 missense probably damaging 1.00
R1619:Cep97 UTSW 16 55927796 missense probably damaging 1.00
R1710:Cep97 UTSW 16 55915022 missense probably damaging 0.99
R1872:Cep97 UTSW 16 55927866 missense probably damaging 1.00
R1878:Cep97 UTSW 16 55905226 missense probably damaging 1.00
R1896:Cep97 UTSW 16 55927744 missense probably damaging 1.00
R5401:Cep97 UTSW 16 55924952 missense probably benign 0.03
R5520:Cep97 UTSW 16 55915296 missense probably benign
R5627:Cep97 UTSW 16 55924967 critical splice donor site probably null
R5632:Cep97 UTSW 16 55915583 missense probably benign 0.02
R5903:Cep97 UTSW 16 55919526 missense probably damaging 1.00
R5914:Cep97 UTSW 16 55905457 missense probably benign 0.02
R6185:Cep97 UTSW 16 55915092 missense probably benign
R6381:Cep97 UTSW 16 55922171 missense probably damaging 1.00
R7041:Cep97 UTSW 16 55905754 missense probably benign
R7371:Cep97 UTSW 16 55905320 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCGGAGAACAAGCGAG -3'
(R):5'- CTCTTCGGATCAGAGTTCGGAC -3'

Sequencing Primer
(F):5'- TGCCACATCGTCAGAATCGG -3'
(R):5'- ATCAGAGTTCGGACTGGCTC -3'
Posted On2019-05-13