Mutagenetix > Incidental Mutation

Incidental Mutation 'R7057:Cr2'

547960

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R7057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 195151610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 957 (D957G)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082321
AA Change: D957G

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: D957G

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193356
AA Change: D660G

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: D660G

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195120
AA Change: D957G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: D957G

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: D1333G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	T	A	6: 40,968,247	V220D	probably benign	Het
Ankrd1	T	C	19: 36,118,233	E113G	possibly damaging	Het
Aqp12	T	C	1: 93,011,996	L249P	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,980	F15S	possibly damaging	Het
Bub1	T	A	2: 127,829,527	M46L	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C2cd4d	A	G	3: 94,363,493	H22R	probably benign	Het
Ccdc157	A	G	11: 4,144,586	V480A	probably benign	Het
Cdc42ep3	G	A	17: 79,335,523		probably benign	Het
Cela1	T	A	15: 100,682,893	T161S	possibly damaging	Het
Chtf18	G	T	17: 25,721,126	A697E	possibly damaging	Het
Cyp2c40	A	G	19: 39,807,619	V60A	probably damaging	Het
Dazl	CCATGATGGCGGC	CC	17: 50,293,406		probably null	Het
Dock2	A	T	11: 34,227,684	L1824Q	probably benign	Het
Dock2	T	C	11: 34,695,217	Y546C	probably benign	Het
Fam208a	A	T	14: 27,461,651	N689I	probably damaging	Het
Focad	G	A	4: 88,274,105	C557Y	unknown	Het
Ftmt	T	A	18: 52,332,108	N165K	probably benign	Het
Gen1	A	C	12: 11,242,418	S457A	probably benign	Het
Gja1	T	G	10: 56,388,033	S163A	probably benign	Het
Gm8267	T	C	14: 44,722,024	I194M	probably damaging	Het
Golga3	T	A	5: 110,188,663	S389R	probably damaging	Het
Gpc5	C	A	14: 115,133,242	Q87K	possibly damaging	Het
Hmcn2	G	A	2: 31,422,649	A3420T	probably damaging	Het
Htt	A	G	5: 34,821,723	S817G	probably null	Het
Hus1b	C	T	13: 30,947,550	C42Y	possibly damaging	Het
Iars2	A	G	1: 185,289,367	F913L	probably benign	Het
Kcna4	A	G	2: 107,295,320	E133G	probably damaging	Het
Klhl36	T	C	8: 119,876,797	L597P	probably benign	Het
Ltv1	T	C	10: 13,180,902	E299G	possibly damaging	Het
Mmp12	A	G	9: 7,357,840	Y348C	probably damaging	Het
Mmp12	G	A	9: 7,369,173	V270I	probably benign	Het
Mmp2	A	G	8: 92,831,705	D134G	probably damaging	Het
Mrpl15	A	T	1: 4,776,642	M237K	probably benign	Het
Ms4a6b	G	T	19: 11,526,889	V177F	possibly damaging	Het
Muc16	A	G	9: 18,646,079	S2973P	unknown	Het
Olfr1219	A	C	2: 89,074,464	I209S	possibly damaging	Het
Olfr1445	A	T	19: 12,884,642	I254F	probably damaging	Het
Olfr1477	G	T	19: 13,502,879	D179Y	probably damaging	Het
Olfr390	A	C	11: 73,787,148	D70A	possibly damaging	Het
Olfr912	A	T	9: 38,581,754	H159L	probably damaging	Het
Pikfyve	T	A	1: 65,247,205	I1201K	probably benign	Het
Plekhn1	T	G	4: 156,233,917	M83L	probably damaging	Het
Pnlip	G	T	19: 58,676,263	D212Y	probably damaging	Het
Pomt2	T	C	12: 87,127,378	N417S	probably damaging	Het
Pxylp1	T	A	9: 96,825,050	M360L	probably benign	Het
Rbak	G	A	5: 143,173,927	T457I	possibly damaging	Het
Runx2	A	T	17: 44,814,537	W31R	probably null	Het
Sec16a	T	A	2: 26,425,265	I1795F	probably damaging	Het
Sik2	A	T	9: 50,998,561	I64N	probably damaging	Het
Slc26a8	T	C	17: 28,638,397	E924G	possibly damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Slc45a4	C	A	15: 73,587,638	D174Y	probably damaging	Het
Slc6a6	A	C	6: 91,741,267	E354A	probably damaging	Het
Slc8a1	A	T	17: 81,649,095	S171R	probably damaging	Het
Srgap1	T	C	10: 121,804,953	I669M	probably benign	Het
Stk39	C	A	2: 68,410,127	A87S	possibly damaging	Het
Tbx18	C	A	9: 87,705,264	S600I	possibly damaging	Het
Tesc	A	C	5: 118,054,960	K114Q	probably damaging	Het
Tll1	T	C	8: 64,101,881	D256G	probably damaging	Het
Tmem35b	T	A	4: 127,127,886	I45K	probably benign	Het
Tnks	T	C	8: 34,840,014	D1127G	probably damaging	Het
Trpm8	A	T	1: 88,362,080	D920V	probably null	Het
U2af1	A	T	17: 31,648,857	D79E	probably benign	Het
Zfp704	T	C	3: 9,470,917	D331G	probably damaging	Het
Znrf3	G	T	11: 5,282,442	P261Q	probably benign	Het
Zscan4b	A	T	7: 10,901,709	C202*	probably null	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GATGTGCCCCATACTCAACTATAC -3'
(R):5'- CTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGCCCCATACTCAACTATACTTTTC -3'
(R):5'- GGGATTTCAACCTGGGAA -3'

Posted On

2019-05-13