Incidental Mutation 'R7057:Cr2'
ID 547960
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045154-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R7057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 194833918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 957 (D957G)
Ref Sequence ENSEMBL: ENSMUSP00000141538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: D957G

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: D957G

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193356
AA Change: D660G

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: D660G

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195120
AA Change: D957G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: D957G

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: D1333G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,945,181 (GRCm39) V220D probably benign Het
Ankrd1 T C 19: 36,095,633 (GRCm39) E113G possibly damaging Het
Aqp12 T C 1: 92,939,718 (GRCm39) L249P probably damaging Het
Atg4a-ps A G 3: 103,553,296 (GRCm39) F15S possibly damaging Het
Bub1 T A 2: 127,671,447 (GRCm39) M46L probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
C2cd4d A G 3: 94,270,800 (GRCm39) H22R probably benign Het
Ccdc157 A G 11: 4,094,586 (GRCm39) V480A probably benign Het
Cdc42ep3 G A 17: 79,642,952 (GRCm39) probably benign Het
Cela1 T A 15: 100,580,774 (GRCm39) T161S possibly damaging Het
Chtf18 G T 17: 25,940,100 (GRCm39) A697E possibly damaging Het
Cyp2c40 A G 19: 39,796,063 (GRCm39) V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,600,434 (GRCm39) probably null Het
Dock2 A T 11: 34,177,684 (GRCm39) L1824Q probably benign Het
Dock2 T C 11: 34,586,044 (GRCm39) Y546C probably benign Het
Focad G A 4: 88,192,342 (GRCm39) C557Y unknown Het
Ftmt T A 18: 52,465,180 (GRCm39) N165K probably benign Het
Gen1 A C 12: 11,292,419 (GRCm39) S457A probably benign Het
Gja1 T G 10: 56,264,129 (GRCm39) S163A probably benign Het
Gm8267 T C 14: 44,959,481 (GRCm39) I194M probably damaging Het
Golga3 T A 5: 110,336,529 (GRCm39) S389R probably damaging Het
Gpc5 C A 14: 115,370,654 (GRCm39) Q87K possibly damaging Het
Hmcn2 G A 2: 31,312,661 (GRCm39) A3420T probably damaging Het
Htt A G 5: 34,979,067 (GRCm39) S817G probably null Het
Hus1b C T 13: 31,131,533 (GRCm39) C42Y possibly damaging Het
Iars2 A G 1: 185,021,564 (GRCm39) F913L probably benign Het
Kcna4 A G 2: 107,125,665 (GRCm39) E133G probably damaging Het
Klhl36 T C 8: 120,603,536 (GRCm39) L597P probably benign Het
Ltv1 T C 10: 13,056,646 (GRCm39) E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 (GRCm39) Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 (GRCm39) V270I probably benign Het
Mmp2 A G 8: 93,558,333 (GRCm39) D134G probably damaging Het
Mrpl15 A T 1: 4,846,865 (GRCm39) M237K probably benign Het
Ms4a6b G T 19: 11,504,253 (GRCm39) V177F possibly damaging Het
Muc16 A G 9: 18,557,375 (GRCm39) S2973P unknown Het
Or1e30 A C 11: 73,677,974 (GRCm39) D70A possibly damaging Het
Or4c114 A C 2: 88,904,808 (GRCm39) I209S possibly damaging Het
Or5b120 G T 19: 13,480,243 (GRCm39) D179Y probably damaging Het
Or5b12b A T 19: 12,862,006 (GRCm39) I254F probably damaging Het
Or8b48 A T 9: 38,493,050 (GRCm39) H159L probably damaging Het
Pikfyve T A 1: 65,286,364 (GRCm39) I1201K probably benign Het
Plekhn1 T G 4: 156,318,374 (GRCm39) M83L probably damaging Het
Pnlip G T 19: 58,664,695 (GRCm39) D212Y probably damaging Het
Pomt2 T C 12: 87,174,152 (GRCm39) N417S probably damaging Het
Pxylp1 T A 9: 96,707,103 (GRCm39) M360L probably benign Het
Rbak G A 5: 143,159,682 (GRCm39) T457I possibly damaging Het
Runx2 A T 17: 45,125,424 (GRCm39) W31R probably null Het
Sec16a T A 2: 26,315,277 (GRCm39) I1795F probably damaging Het
Sik2 A T 9: 50,909,861 (GRCm39) I64N probably damaging Het
Slc26a8 T C 17: 28,857,371 (GRCm39) E924G possibly damaging Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Slc45a4 C A 15: 73,459,487 (GRCm39) D174Y probably damaging Het
Slc6a6 A C 6: 91,718,248 (GRCm39) E354A probably damaging Het
Slc8a1 A T 17: 81,956,524 (GRCm39) S171R probably damaging Het
Srgap1 T C 10: 121,640,858 (GRCm39) I669M probably benign Het
Stk39 C A 2: 68,240,471 (GRCm39) A87S possibly damaging Het
Tasor A T 14: 27,183,608 (GRCm39) N689I probably damaging Het
Tbx18 C A 9: 87,587,317 (GRCm39) S600I possibly damaging Het
Tesc A C 5: 118,193,025 (GRCm39) K114Q probably damaging Het
Tll1 T C 8: 64,554,915 (GRCm39) D256G probably damaging Het
Tmem35b T A 4: 127,021,679 (GRCm39) I45K probably benign Het
Tnks T C 8: 35,307,168 (GRCm39) D1127G probably damaging Het
Trpm8 A T 1: 88,289,802 (GRCm39) D920V probably null Het
U2af1 A T 17: 31,867,831 (GRCm39) D79E probably benign Het
Zfp704 T C 3: 9,535,977 (GRCm39) D331G probably damaging Het
Znrf3 G T 11: 5,232,442 (GRCm39) P261Q probably benign Het
Zscan4b A T 7: 10,635,636 (GRCm39) C202* probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GATGTGCCCCATACTCAACTATAC -3'
(R):5'- CTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGCCCCATACTCAACTATACTTTTC -3'
(R):5'- GGGATTTCAACCTGGGAA -3'
Posted On 2019-05-13