Mutagenetix > Incidental Mutations

Incidental Mutation 'R7057:Hmcn2'

547962

Institutional Source

Beutler Lab

Gene Symbol

Hmcn2

Ensembl Gene

ENSMUSG00000055632

Gene Name

hemicentin 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31314415-31460738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31422649 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 3420 (A3420T)

Ref Sequence

ENSEMBL: ENSMUSP00000109160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]

Predicted Effect

probably damaging
Transcript: ENSMUST00000113532
AA Change: A3420T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: A3420T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VWA	37	211	1.21e-1	SMART
Blast:IG_like	263	340	2e-38	BLAST
IG	434	515	7.36e-2	SMART
IGc2	530	595	1.91e-9	SMART
IGc2	621	685	4.81e-15	SMART
IGc2	711	773	1.09e-13	SMART
IGc2	799	866	2.72e-14	SMART
IGc2	894	959	1.95e-15	SMART
IGc2	985	1049	5e-13	SMART
IGc2	1082	1147	1.09e-13	SMART
low complexity region	1151	1169	N/A	INTRINSIC
IGc2	1173	1232	7.07e-13	SMART
IGc2	1260	1326	4.31e-17	SMART
IGc2	1354	1428	3e-16	SMART
IGc2	1456	1522	1.82e-15	SMART
IGc2	1550	1615	2.7e-18	SMART
IGc2	1644	1708	1.3e-11	SMART
IGc2	1736	1801	6.69e-14	SMART
IG	1826	1917	2.31e0	SMART
IGc2	1932	1997	4.62e-17	SMART
IGc2	2024	2091	3.25e-12	SMART
IGc2	2117	2182	1.28e-10	SMART
IGc2	2209	2276	3.76e-8	SMART
IGc2	2305	2370	2.6e-11	SMART
IGc2	2399	2464	1.32e-12	SMART
IGc2	2492	2557	2.06e-14	SMART
IGc2	2588	2653	3.9e-15	SMART
IGc2	2686	2751	2.64e-12	SMART
IGc2	2797	2862	9.05e-11	SMART
IGc2	2892	2957	4.7e-9	SMART
IGc2	2984	3049	1.44e-13	SMART
IGc2	3079	3144	9.33e-13	SMART
IGc2	3171	3236	3.79e-13	SMART
IGc2	3264	3331	1.85e-16	SMART
IGc2	3360	3425	9.61e-15	SMART
low complexity region	3433	3445	N/A	INTRINSIC
IGc2	3453	3514	5.83e-14	SMART
IGc2	3542	3600	1.76e-8	SMART
low complexity region	3613	3627	N/A	INTRINSIC
IGc2	3628	3693	5.2e-11	SMART
IGc2	3719	3784	2.64e-12	SMART
IGc2	3810	3877	3.35e-5	SMART
IGc2	3903	3968	3.73e-12	SMART
IGc2	3994	4058	4.39e-9	SMART
IGc2	4084	4149	1.79e-14	SMART
low complexity region	4157	4169	N/A	INTRINSIC
IGc2	4175	4238	9.33e-13	SMART
IGc2	4265	4329	7.22e-19	SMART
IGc2	4355	4419	1.59e-15	SMART
Pfam:G2F	4431	4613	1.7e-56	PFAM
EGF_CA	4668	4708	5.78e-11	SMART
EGF_CA	4709	4753	9.39e-11	SMART
EGF_CA	4754	4796	7.69e-7	SMART
EGF_CA	4797	4837	2.19e-11	SMART
EGF_CA	4904	4943	6.74e-12	SMART
EGF_like	4944	4989	1.87e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226996

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	T	A	6: 40,968,247	V220D	probably benign	Het
Ankrd1	T	C	19: 36,118,233	E113G	possibly damaging	Het
Aqp12	T	C	1: 93,011,996	L249P	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,980	F15S	possibly damaging	Het
Bub1	T	A	2: 127,829,527	M46L	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C2cd4d	A	G	3: 94,363,493	H22R	probably benign	Het
Ccdc157	A	G	11: 4,144,586	V480A	probably benign	Het
Cdc42ep3	G	A	17: 79,335,523		probably benign	Het
Cela1	T	A	15: 100,682,893	T161S	possibly damaging	Het
Chtf18	G	T	17: 25,721,126	A697E	possibly damaging	Het
Cr2	T	C	1: 195,151,610	D957G	possibly damaging	Het
Cyp2c40	A	G	19: 39,807,619	V60A	probably damaging	Het
Dazl	CCATGATGGCGGC	CC	17: 50,293,406		probably null	Het
Dock2	A	T	11: 34,227,684	L1824Q	probably benign	Het
Dock2	T	C	11: 34,695,217	Y546C	probably benign	Het
Fam208a	A	T	14: 27,461,651	N689I	probably damaging	Het
Focad	G	A	4: 88,274,105	C557Y	unknown	Het
Ftmt	T	A	18: 52,332,108	N165K	probably benign	Het
Gen1	A	C	12: 11,242,418	S457A	probably benign	Het
Gja1	T	G	10: 56,388,033	S163A	probably benign	Het
Gm8267	T	C	14: 44,722,024	I194M	probably damaging	Het
Golga3	T	A	5: 110,188,663	S389R	probably damaging	Het
Gpc5	C	A	14: 115,133,242	Q87K	possibly damaging	Het
Htt	A	G	5: 34,821,723	S817G	probably null	Het
Hus1b	C	T	13: 30,947,550	C42Y	possibly damaging	Het
Iars2	A	G	1: 185,289,367	F913L	probably benign	Het
Kcna4	A	G	2: 107,295,320	E133G	probably damaging	Het
Klhl36	T	C	8: 119,876,797	L597P	probably benign	Het
Ltv1	T	C	10: 13,180,902	E299G	possibly damaging	Het
Mmp12	A	G	9: 7,357,840	Y348C	probably damaging	Het
Mmp12	G	A	9: 7,369,173	V270I	probably benign	Het
Mmp2	A	G	8: 92,831,705	D134G	probably damaging	Het
Mrpl15	A	T	1: 4,776,642	M237K	probably benign	Het
Ms4a6b	G	T	19: 11,526,889	V177F	possibly damaging	Het
Muc16	A	G	9: 18,646,079	S2973P	unknown	Het
Olfr1219	A	C	2: 89,074,464	I209S	possibly damaging	Het
Olfr1445	A	T	19: 12,884,642	I254F	probably damaging	Het
Olfr1477	G	T	19: 13,502,879	D179Y	probably damaging	Het
Olfr390	A	C	11: 73,787,148	D70A	possibly damaging	Het
Olfr912	A	T	9: 38,581,754	H159L	probably damaging	Het
Pikfyve	T	A	1: 65,247,205	I1201K	probably benign	Het
Plekhn1	T	G	4: 156,233,917	M83L	probably damaging	Het
Pnlip	G	T	19: 58,676,263	D212Y	probably damaging	Het
Pomt2	T	C	12: 87,127,378	N417S	probably damaging	Het
Pxylp1	T	A	9: 96,825,050	M360L	probably benign	Het
Rbak	G	A	5: 143,173,927	T457I	possibly damaging	Het
Runx2	A	T	17: 44,814,537	W31R	probably null	Het
Sec16a	T	A	2: 26,425,265	I1795F	probably damaging	Het
Sik2	A	T	9: 50,998,561	I64N	probably damaging	Het
Slc26a8	T	C	17: 28,638,397	E924G	possibly damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Slc45a4	C	A	15: 73,587,638	D174Y	probably damaging	Het
Slc6a6	A	C	6: 91,741,267	E354A	probably damaging	Het
Slc8a1	A	T	17: 81,649,095	S171R	probably damaging	Het
Srgap1	T	C	10: 121,804,953	I669M	probably benign	Het
Stk39	C	A	2: 68,410,127	A87S	possibly damaging	Het
Tbx18	C	A	9: 87,705,264	S600I	possibly damaging	Het
Tesc	A	C	5: 118,054,960	K114Q	probably damaging	Het
Tll1	T	C	8: 64,101,881	D256G	probably damaging	Het
Tmem35b	T	A	4: 127,127,886	I45K	probably benign	Het
Tnks	T	C	8: 34,840,014	D1127G	probably damaging	Het
Trpm8	A	T	1: 88,362,080	D920V	probably null	Het
U2af1	A	T	17: 31,648,857	D79E	probably benign	Het
Zfp704	T	C	3: 9,470,917	D331G	probably damaging	Het
Znrf3	G	T	11: 5,282,442	P261Q	probably benign	Het
Zscan4b	A	T	7: 10,901,709	C202*	probably null	Het

Other mutations in Hmcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Hmcn2	APN	2	31343096	missense	probably damaging	1.00
IGL00966:Hmcn2	APN	2	31428994	missense	probably damaging	0.97
IGL00973:Hmcn2	APN	2	31383821	intron	probably benign
IGL01364:Hmcn2	APN	2	31361814	nonsense	probably null
IGL01486:Hmcn2	APN	2	31336621	missense	probably damaging	1.00
IGL01530:Hmcn2	APN	2	31354264	missense	possibly damaging	0.85
IGL01550:Hmcn2	APN	2	31424252	missense	possibly damaging	0.84
IGL01710:Hmcn2	APN	2	31343102	missense	probably damaging	1.00
IGL01764:Hmcn2	APN	2	31405630	missense	possibly damaging	0.93
IGL01924:Hmcn2	APN	2	31398917	missense	probably benign	0.00
IGL02003:Hmcn2	APN	2	31428982	missense	possibly damaging	0.90
IGL02117:Hmcn2	APN	2	31457173	missense	possibly damaging	0.75
IGL02205:Hmcn2	APN	2	31400127	missense	probably damaging	1.00
IGL02273:Hmcn2	APN	2	31424377	missense	probably benign	0.06
IGL02313:Hmcn2	APN	2	31453605	missense	possibly damaging	0.68
IGL02326:Hmcn2	APN	2	31450952	missense	probably damaging	0.97
IGL02486:Hmcn2	APN	2	31420095	missense	probably damaging	0.98
IGL02551:Hmcn2	APN	2	31454811	missense	possibly damaging	0.83
IGL02695:Hmcn2	APN	2	31408973	missense	possibly damaging	0.87
IGL02725:Hmcn2	APN	2	31405528	missense	probably damaging	1.00
IGL02792:Hmcn2	APN	2	31346590	missense	probably damaging	1.00
IGL02882:Hmcn2	APN	2	31413367	nonsense	probably null
IGL03003:Hmcn2	APN	2	31433486	missense	probably damaging	0.98
IGL03067:Hmcn2	APN	2	31346630	missense	probably damaging	1.00
IGL03137:Hmcn2	APN	2	31362230	missense	probably damaging	0.98
IGL03220:Hmcn2	APN	2	31346621	missense	possibly damaging	0.94
IGL03411:Hmcn2	APN	2	31346637	missense	possibly damaging	0.83
PIT4544001:Hmcn2	UTSW	2	31428250	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0078:Hmcn2	UTSW	2	31388344	missense	probably damaging	1.00
R0090:Hmcn2	UTSW	2	31426198	missense	probably damaging	1.00
R0173:Hmcn2	UTSW	2	31438331	critical splice donor site	probably null
R0257:Hmcn2	UTSW	2	31369164	splice site	probably benign
R0266:Hmcn2	UTSW	2	31394827	missense	probably benign	0.03
R0266:Hmcn2	UTSW	2	31445353	splice site	probably benign
R0326:Hmcn2	UTSW	2	31423225	nonsense	probably null
R0366:Hmcn2	UTSW	2	31424206	missense	possibly damaging	0.88
R0400:Hmcn2	UTSW	2	31400129	missense	probably damaging	0.98
R0412:Hmcn2	UTSW	2	31388247	missense	probably damaging	0.98
R0436:Hmcn2	UTSW	2	31405612	missense	probably damaging	1.00
R0457:Hmcn2	UTSW	2	31415284	critical splice donor site	probably null
R0487:Hmcn2	UTSW	2	31386677	missense	possibly damaging	0.60
R0568:Hmcn2	UTSW	2	31415236	missense	probably benign	0.02
R0755:Hmcn2	UTSW	2	31453160	missense	probably damaging	0.99
R0811:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0812:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0964:Hmcn2	UTSW	2	31391511	missense	probably benign	0.23
R0988:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R1484:Hmcn2	UTSW	2	31346495	missense	probably damaging	1.00
R1509:Hmcn2	UTSW	2	31314479	missense	possibly damaging	0.86
R1535:Hmcn2	UTSW	2	31420407	missense	possibly damaging	0.91
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1600:Hmcn2	UTSW	2	31430787	missense	probably damaging	0.98
R1623:Hmcn2	UTSW	2	31458039	missense	possibly damaging	0.84
R1692:Hmcn2	UTSW	2	31450844	missense	possibly damaging	0.47
R1719:Hmcn2	UTSW	2	31354721	missense	probably damaging	1.00
R1747:Hmcn2	UTSW	2	31457985	missense	probably benign	0.00
R1756:Hmcn2	UTSW	2	31396120	missense	probably damaging	0.99
R1763:Hmcn2	UTSW	2	31314590	missense	probably damaging	1.00
R1815:Hmcn2	UTSW	2	31393043	missense	probably damaging	0.97
R1822:Hmcn2	UTSW	2	31383692	missense	probably damaging	0.99
R1858:Hmcn2	UTSW	2	31415283	critical splice donor site	probably null
R1895:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1908:Hmcn2	UTSW	2	31411910	critical splice donor site	probably null
R1946:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1966:Hmcn2	UTSW	2	31389329	missense	probably damaging	0.99
R2007:Hmcn2	UTSW	2	31438255	missense	possibly damaging	0.91
R2050:Hmcn2	UTSW	2	31335436	missense	probably damaging	1.00
R2055:Hmcn2	UTSW	2	31378282	missense	probably benign	0.33
R2097:Hmcn2	UTSW	2	31380419	missense	probably damaging	1.00
R2145:Hmcn2	UTSW	2	31333931	splice site	probably benign
R2155:Hmcn2	UTSW	2	31460349	missense	possibly damaging	0.68
R2170:Hmcn2	UTSW	2	31380281	missense	probably benign	0.08
R2188:Hmcn2	UTSW	2	31419935	missense	probably benign	0.14
R2208:Hmcn2	UTSW	2	31380297	missense	probably damaging	1.00
R2217:Hmcn2	UTSW	2	31350574	missense	probably benign	0.02
R2407:Hmcn2	UTSW	2	31335412	critical splice acceptor site	probably null
R2764:Hmcn2	UTSW	2	31388298	missense	probably damaging	0.98
R2913:Hmcn2	UTSW	2	31460210	missense	possibly damaging	0.68
R2986:Hmcn2	UTSW	2	31360998	missense	probably damaging	1.00
R3157:Hmcn2	UTSW	2	31400255	missense	probably damaging	0.99
R3406:Hmcn2	UTSW	2	31433272	splice site	probably benign
R3429:Hmcn2	UTSW	2	31409144	missense	possibly damaging	0.87
R3737:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3739:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3771:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3772:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3773:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3804:Hmcn2	UTSW	2	31352885	splice site	probably null
R3837:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3838:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3846:Hmcn2	UTSW	2	31430350	missense	possibly damaging	0.51
R3925:Hmcn2	UTSW	2	31453157	missense	probably benign	0.00
R3934:Hmcn2	UTSW	2	31380484	critical splice donor site	probably null
R3946:Hmcn2	UTSW	2	31382394	missense	possibly damaging	0.91
R4035:Hmcn2	UTSW	2	31336612	nonsense	probably null
R4057:Hmcn2	UTSW	2	31400238	missense	probably damaging	1.00
R4583:Hmcn2	UTSW	2	31413265	missense	possibly damaging	0.84
R4623:Hmcn2	UTSW	2	31396710	missense	probably damaging	1.00
R4647:Hmcn2	UTSW	2	31399019	missense	possibly damaging	0.82
R4668:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4669:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4687:Hmcn2	UTSW	2	31438285	missense	probably benign	0.14
R4735:Hmcn2	UTSW	2	31383775	missense	probably benign	0.06
R4772:Hmcn2	UTSW	2	31445314	missense	probably benign	0.02
R4866:Hmcn2	UTSW	2	31389391	missense	possibly damaging	0.88
R4916:Hmcn2	UTSW	2	31360980	missense	probably damaging	0.98
R4943:Hmcn2	UTSW	2	31335492	missense	probably damaging	1.00
R4967:Hmcn2	UTSW	2	31354164	critical splice acceptor site	probably null
R4973:Hmcn2	UTSW	2	31344096	missense	probably benign	0.15
R4975:Hmcn2	UTSW	2	31393025	missense	possibly damaging	0.88
R4994:Hmcn2	UTSW	2	31458055	critical splice donor site	probably null
R4997:Hmcn2	UTSW	2	31401708	missense	probably damaging	1.00
R5045:Hmcn2	UTSW	2	31409081	missense	probably damaging	1.00
R5117:Hmcn2	UTSW	2	31458049	missense	possibly damaging	0.95
R5151:Hmcn2	UTSW	2	31389443	missense	probably null
R5232:Hmcn2	UTSW	2	31457748	missense	probably damaging	0.99
R5237:Hmcn2	UTSW	2	31414716	missense	probably benign	0.01
R5288:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5375:Hmcn2	UTSW	2	31430441	missense	possibly damaging	0.92
R5379:Hmcn2	UTSW	2	31409011	missense	probably damaging	0.99
R5385:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5412:Hmcn2	UTSW	2	31346617	missense	possibly damaging	0.77
R5426:Hmcn2	UTSW	2	31336544	missense	possibly damaging	0.95
R5434:Hmcn2	UTSW	2	31420363	missense	probably damaging	1.00
R5441:Hmcn2	UTSW	2	31406416	missense	possibly damaging	0.82
R5484:Hmcn2	UTSW	2	31393054	nonsense	probably null
R5492:Hmcn2	UTSW	2	31420306	missense	probably benign	0.03
R5572:Hmcn2	UTSW	2	31414525	critical splice acceptor site	probably null
R5572:Hmcn2	UTSW	2	31414526	critical splice acceptor site	probably null
R5591:Hmcn2	UTSW	2	31344047	missense	probably damaging	1.00
R5614:Hmcn2	UTSW	2	31428303	missense	probably damaging	0.99
R5634:Hmcn2	UTSW	2	31333881	missense	probably damaging	1.00
R5645:Hmcn2	UTSW	2	31420812	missense	possibly damaging	0.92
R5716:Hmcn2	UTSW	2	31336567	missense	probably damaging	1.00
R5716:Hmcn2	UTSW	2	31458738	missense	possibly damaging	0.68
R5725:Hmcn2	UTSW	2	31383815	critical splice donor site	probably null
R5760:Hmcn2	UTSW	2	31414568	missense	possibly damaging	0.91
R5774:Hmcn2	UTSW	2	31409135	missense	possibly damaging	0.94
R5838:Hmcn2	UTSW	2	31457807	missense	probably damaging	0.99
R5899:Hmcn2	UTSW	2	31354673	missense	possibly damaging	0.93
R5916:Hmcn2	UTSW	2	31396139	missense	probably damaging	1.00
R5973:Hmcn2	UTSW	2	31420323	missense	probably damaging	0.99
R6002:Hmcn2	UTSW	2	31420309	missense	probably damaging	0.99
R6018:Hmcn2	UTSW	2	31370792	missense	probably benign	0.13
R6063:Hmcn2	UTSW	2	31434713	missense	probably benign	0.06
R6161:Hmcn2	UTSW	2	31356254	missense	probably benign
R6166:Hmcn2	UTSW	2	31369262	missense	probably damaging	1.00
R6177:Hmcn2	UTSW	2	31420106	nonsense	probably null
R6191:Hmcn2	UTSW	2	31458746	missense	probably damaging	0.99
R6195:Hmcn2	UTSW	2	31384115	missense	probably damaging	0.96
R6273:Hmcn2	UTSW	2	31411834	missense	probably damaging	0.99
R6293:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R6349:Hmcn2	UTSW	2	31388373	missense	probably damaging	1.00
R6395:Hmcn2	UTSW	2	31369257	missense	probably damaging	1.00
R6448:Hmcn2	UTSW	2	31420820	missense	probably benign	0.02
R6450:Hmcn2	UTSW	2	31361800	missense	probably benign	0.11
R6479:Hmcn2	UTSW	2	31425468	missense	probably damaging	0.99
R6502:Hmcn2	UTSW	2	31382478	missense	probably damaging	0.99
R6511:Hmcn2	UTSW	2	31356342	missense	possibly damaging	0.79
R6537:Hmcn2	UTSW	2	31415268	missense	probably benign	0.00
R6880:Hmcn2	UTSW	2	31343056	missense	probably damaging	1.00
R6924:Hmcn2	UTSW	2	31350505	splice site	probably null
R6971:Hmcn2	UTSW	2	31432321	missense	probably benign	0.02
R7141:Hmcn2	UTSW	2	31360896	missense	probably benign	0.17
R7268:Hmcn2	UTSW	2	31457966	missense	possibly damaging	0.48
R7307:Hmcn2	UTSW	2	31343081	missense	probably damaging	0.96
R7322:Hmcn2	UTSW	2	31459081	missense	probably damaging	0.99
R7334:Hmcn2	UTSW	2	31435794	missense	probably damaging	0.98
R7334:Hmcn2	UTSW	2	31453135	missense	possibly damaging	0.82
R7335:Hmcn2	UTSW	2	31392157	missense	possibly damaging	0.88
R7358:Hmcn2	UTSW	2	31416812	missense	probably damaging	1.00
R7359:Hmcn2	UTSW	2	31388383	missense	probably benign	0.13
R7488:Hmcn2	UTSW	2	31420830	missense	probably damaging	1.00
R7498:Hmcn2	UTSW	2	31383475	intron	probably null
R7560:Hmcn2	UTSW	2	31457173	missense	probably benign
R7566:Hmcn2	UTSW	2	31454857	missense	probably damaging	0.96
R7570:Hmcn2	UTSW	2	31423911	missense	probably benign
R7574:Hmcn2	UTSW	2	31455519	missense	possibly damaging	0.68
R7599:Hmcn2	UTSW	2	31356286	missense	possibly damaging	0.93
R7654:Hmcn2	UTSW	2	31346569	missense	probably benign	0.00
R7662:Hmcn2	UTSW	2	31382345	missense	probably benign	0.01
R7666:Hmcn2	UTSW	2	31380233	missense	probably damaging	1.00
R7698:Hmcn2	UTSW	2	31423153	missense	probably damaging	0.98
R7722:Hmcn2	UTSW	2	31382500	nonsense	probably null
R7739:Hmcn2	UTSW	2	31458026	missense	possibly damaging	0.48
R7828:Hmcn2	UTSW	2	31405875	missense	possibly damaging	0.95
X0066:Hmcn2	UTSW	2	31454811	missense	possibly damaging	0.83
X0067:Hmcn2	UTSW	2	31405867	missense	possibly damaging	0.82
Z1088:Hmcn2	UTSW	2	31459064	intron	probably null
Z1088:Hmcn2	UTSW	2	31381067	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATATGAAGTGGGCTAGAGGGTTCTC -3'
(R):5'- AGTGCCTGCTCACAACTTGG -3'

Sequencing Primer
(F):5'- AGGGTTCTCCTTACAGAATCAGC -3'
(R):5'- CTGCTCACAACTTGGGGGATAAATG -3'

Posted On

2019-05-13