Mutagenetix > Incidental Mutations

Incidental Mutation 'R7057:Stk39'

547963

Institutional Source

Beutler Lab

Gene Symbol

Stk39

Ensembl Gene

ENSMUSG00000027030

Gene Name

serine/threonine kinase 39

Synonyms

DCHT, Rnl5, RF005, SPAK

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.684) question?

Stock #

R7057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68210445-68472268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 68410127 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 87 (A87S)

Ref Sequence

ENSEMBL: ENSMUSP00000099776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102715]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102715
AA Change: A87S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: A87S

Domain	Start	End	E-Value	Type
low complexity region	14	65	N/A	INTRINSIC
S_TKc	75	349	4.44e-80	SMART
Pfam:OSR1_C	463	494	1.3e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	T	A	6: 40,968,247	V220D	probably benign	Het
Ankrd1	T	C	19: 36,118,233	E113G	possibly damaging	Het
Aqp12	T	C	1: 93,011,996	L249P	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,980	F15S	possibly damaging	Het
Bub1	T	A	2: 127,829,527	M46L	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C2cd4d	A	G	3: 94,363,493	H22R	probably benign	Het
Ccdc157	A	G	11: 4,144,586	V480A	probably benign	Het
Cdc42ep3	G	A	17: 79,335,523		probably benign	Het
Cela1	T	A	15: 100,682,893	T161S	possibly damaging	Het
Chtf18	G	T	17: 25,721,126	A697E	possibly damaging	Het
Cr2	T	C	1: 195,151,610	D957G	possibly damaging	Het
Cyp2c40	A	G	19: 39,807,619	V60A	probably damaging	Het
Dazl	CCATGATGGCGGC	CC	17: 50,293,406		probably null	Het
Dock2	A	T	11: 34,227,684	L1824Q	probably benign	Het
Dock2	T	C	11: 34,695,217	Y546C	probably benign	Het
Fam208a	A	T	14: 27,461,651	N689I	probably damaging	Het
Focad	G	A	4: 88,274,105	C557Y	unknown	Het
Ftmt	T	A	18: 52,332,108	N165K	probably benign	Het
Gen1	A	C	12: 11,242,418	S457A	probably benign	Het
Gja1	T	G	10: 56,388,033	S163A	probably benign	Het
Gm8267	T	C	14: 44,722,024	I194M	probably damaging	Het
Golga3	T	A	5: 110,188,663	S389R	probably damaging	Het
Gpc5	C	A	14: 115,133,242	Q87K	possibly damaging	Het
Hmcn2	G	A	2: 31,422,649	A3420T	probably damaging	Het
Htt	A	G	5: 34,821,723	S817G	probably null	Het
Hus1b	C	T	13: 30,947,550	C42Y	possibly damaging	Het
Iars2	A	G	1: 185,289,367	F913L	probably benign	Het
Kcna4	A	G	2: 107,295,320	E133G	probably damaging	Het
Klhl36	T	C	8: 119,876,797	L597P	probably benign	Het
Ltv1	T	C	10: 13,180,902	E299G	possibly damaging	Het
Mmp12	A	G	9: 7,357,840	Y348C	probably damaging	Het
Mmp12	G	A	9: 7,369,173	V270I	probably benign	Het
Mmp2	A	G	8: 92,831,705	D134G	probably damaging	Het
Mrpl15	A	T	1: 4,776,642	M237K	probably benign	Het
Ms4a6b	G	T	19: 11,526,889	V177F	possibly damaging	Het
Muc16	A	G	9: 18,646,079	S2973P	unknown	Het
Olfr1219	A	C	2: 89,074,464	I209S	possibly damaging	Het
Olfr1445	A	T	19: 12,884,642	I254F	probably damaging	Het
Olfr1477	G	T	19: 13,502,879	D179Y	probably damaging	Het
Olfr390	A	C	11: 73,787,148	D70A	possibly damaging	Het
Olfr912	A	T	9: 38,581,754	H159L	probably damaging	Het
Pikfyve	T	A	1: 65,247,205	I1201K	probably benign	Het
Plekhn1	T	G	4: 156,233,917	M83L	probably damaging	Het
Pnlip	G	T	19: 58,676,263	D212Y	probably damaging	Het
Pomt2	T	C	12: 87,127,378	N417S	probably damaging	Het
Pxylp1	T	A	9: 96,825,050	M360L	probably benign	Het
Rbak	G	A	5: 143,173,927	T457I	possibly damaging	Het
Runx2	A	T	17: 44,814,537	W31R	probably null	Het
Sec16a	T	A	2: 26,425,265	I1795F	probably damaging	Het
Sik2	A	T	9: 50,998,561	I64N	probably damaging	Het
Slc26a8	T	C	17: 28,638,397	E924G	possibly damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Slc45a4	C	A	15: 73,587,638	D174Y	probably damaging	Het
Slc6a6	A	C	6: 91,741,267	E354A	probably damaging	Het
Slc8a1	A	T	17: 81,649,095	S171R	probably damaging	Het
Srgap1	T	C	10: 121,804,953	I669M	probably benign	Het
Tbx18	C	A	9: 87,705,264	S600I	possibly damaging	Het
Tesc	A	C	5: 118,054,960	K114Q	probably damaging	Het
Tll1	T	C	8: 64,101,881	D256G	probably damaging	Het
Tmem35b	T	A	4: 127,127,886	I45K	probably benign	Het
Tnks	T	C	8: 34,840,014	D1127G	probably damaging	Het
Trpm8	A	T	1: 88,362,080	D920V	probably null	Het
U2af1	A	T	17: 31,648,857	D79E	probably benign	Het
Zfp704	T	C	3: 9,470,917	D331G	probably damaging	Het
Znrf3	G	T	11: 5,282,442	P261Q	probably benign	Het
Zscan4b	A	T	7: 10,901,709	C202*	probably null	Het

Other mutations in Stk39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Stk39	APN	2	68314564	missense	possibly damaging	0.81
IGL00966:Stk39	APN	2	68211958	missense	probably benign	0.01
IGL01936:Stk39	APN	2	68314564	missense	probably benign	0.21
IGL02301:Stk39	APN	2	68211962	missense	probably damaging	1.00
IGL02940:Stk39	APN	2	68220899	splice site	probably null
R0570:Stk39	UTSW	2	68410048	missense	probably damaging	1.00
R0609:Stk39	UTSW	2	68366167	missense	probably damaging	1.00
R0670:Stk39	UTSW	2	68366182	missense	possibly damaging	0.93
R0980:Stk39	UTSW	2	68392171	missense	probably damaging	1.00
R1024:Stk39	UTSW	2	68410046	missense	probably damaging	1.00
R1573:Stk39	UTSW	2	68390949	missense	probably damaging	1.00
R1713:Stk39	UTSW	2	68307116	splice site	probably benign
R2223:Stk39	UTSW	2	68314579	missense	probably damaging	0.96
R3700:Stk39	UTSW	2	68392118	missense	probably damaging	1.00
R4207:Stk39	UTSW	2	68220920	missense	probably benign	0.42
R4298:Stk39	UTSW	2	68390940	missense	probably damaging	1.00
R4726:Stk39	UTSW	2	68263303	missense	probably damaging	1.00
R4975:Stk39	UTSW	2	68220992	intron	probably benign
R5057:Stk39	UTSW	2	68220948	missense	probably damaging	0.99
R5384:Stk39	UTSW	2	68410039	missense	probably damaging	1.00
R5921:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R6125:Stk39	UTSW	2	68392124	missense	probably damaging	1.00
R6251:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R6332:Stk39	UTSW	2	68410043	missense	possibly damaging	0.93
R6375:Stk39	UTSW	2	68392238	missense	probably benign	0.34
R7064:Stk39	UTSW	2	68358812	critical splice donor site	probably null
R7691:Stk39	UTSW	2	68471639	missense	probably damaging	0.97
R7921:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R8155:Stk39	UTSW	2	68267066	missense	probably damaging	1.00
Z1176:Stk39	UTSW	2	68392198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACACTGAGACCACTGG -3'
(R):5'- GTAGGACTTCAGGGACTCTTTG -3'

Sequencing Primer
(F):5'- ACTGAGACCACTGGAACTGCG -3'
(R):5'- TCAGGGACTCTTTGAAGATGCCAC -3'

Posted On

2019-05-13