Incidental Mutation 'R7057:Stk39'
ID547963
Institutional Source Beutler Lab
Gene Symbol Stk39
Ensembl Gene ENSMUSG00000027030
Gene Nameserine/threonine kinase 39
SynonymsDCHT, Rnl5, RF005, SPAK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location68210445-68472268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68410127 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 87 (A87S)
Ref Sequence ENSEMBL: ENSMUSP00000099776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102715
AA Change: A87S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: A87S

DomainStartEndE-ValueType
low complexity region 14 65 N/A INTRINSIC
S_TKc 75 349 4.44e-80 SMART
Pfam:OSR1_C 463 494 1.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Stk39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Stk39 APN 2 68314564 missense possibly damaging 0.81
IGL00966:Stk39 APN 2 68211958 missense probably benign 0.01
IGL01936:Stk39 APN 2 68314564 missense probably benign 0.21
IGL02301:Stk39 APN 2 68211962 missense probably damaging 1.00
IGL02940:Stk39 APN 2 68220899 splice site probably null
R0570:Stk39 UTSW 2 68410048 missense probably damaging 1.00
R0609:Stk39 UTSW 2 68366167 missense probably damaging 1.00
R0670:Stk39 UTSW 2 68366182 missense possibly damaging 0.93
R0980:Stk39 UTSW 2 68392171 missense probably damaging 1.00
R1024:Stk39 UTSW 2 68410046 missense probably damaging 1.00
R1573:Stk39 UTSW 2 68390949 missense probably damaging 1.00
R1713:Stk39 UTSW 2 68307116 splice site probably benign
R2223:Stk39 UTSW 2 68314579 missense probably damaging 0.96
R3700:Stk39 UTSW 2 68392118 missense probably damaging 1.00
R4207:Stk39 UTSW 2 68220920 missense probably benign 0.42
R4298:Stk39 UTSW 2 68390940 missense probably damaging 1.00
R4726:Stk39 UTSW 2 68263303 missense probably damaging 1.00
R4975:Stk39 UTSW 2 68220992 intron probably benign
R5057:Stk39 UTSW 2 68220948 missense probably damaging 0.99
R5384:Stk39 UTSW 2 68410039 missense probably damaging 1.00
R5921:Stk39 UTSW 2 68366105 missense probably damaging 0.97
R6125:Stk39 UTSW 2 68392124 missense probably damaging 1.00
R6251:Stk39 UTSW 2 68307039 critical splice donor site probably null
R6332:Stk39 UTSW 2 68410043 missense possibly damaging 0.93
R6375:Stk39 UTSW 2 68392238 missense probably benign 0.34
R7064:Stk39 UTSW 2 68358812 critical splice donor site probably null
R7691:Stk39 UTSW 2 68471639 missense probably damaging 0.97
R7921:Stk39 UTSW 2 68307039 critical splice donor site probably null
R8155:Stk39 UTSW 2 68267066 missense probably damaging 1.00
Z1176:Stk39 UTSW 2 68392198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACACTGAGACCACTGG -3'
(R):5'- GTAGGACTTCAGGGACTCTTTG -3'

Sequencing Primer
(F):5'- ACTGAGACCACTGGAACTGCG -3'
(R):5'- TCAGGGACTCTTTGAAGATGCCAC -3'
Posted On2019-05-13