Incidental Mutation 'R7057:Olfr1219'
ID547964
Institutional Source Beutler Lab
Gene Symbol Olfr1219
Ensembl Gene ENSMUSG00000075104
Gene Nameolfactory receptor 1219
SynonymsMOR233-6, GA_x6K02T2Q125-50555603-50554668
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89072241-89083513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89074464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 209 (I209S)
Ref Sequence ENSEMBL: ENSMUSP00000150043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099797] [ENSMUST00000213724] [ENSMUST00000214442] [ENSMUST00000215225] [ENSMUST00000217421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099797
AA Change: I209S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097385
Gene: ENSMUSG00000075104
AA Change: I209S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3e-46 PFAM
Pfam:7tm_1 39 286 1.5e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213724
AA Change: I209S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214442
AA Change: I209S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215225
AA Change: I209S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217421
AA Change: I209S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Olfr1219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr1219 APN 2 89074201 missense probably benign 0.04
R0437:Olfr1219 UTSW 2 89074612 missense probably benign 0.00
R0653:Olfr1219 UTSW 2 89074464 missense possibly damaging 0.90
R1637:Olfr1219 UTSW 2 89075052 missense probably damaging 1.00
R1837:Olfr1219 UTSW 2 89074832 nonsense probably null
R1906:Olfr1219 UTSW 2 89075070 missense possibly damaging 0.93
R2234:Olfr1219 UTSW 2 89074248 missense probably damaging 1.00
R2351:Olfr1219 UTSW 2 89074399 missense possibly damaging 0.74
R2420:Olfr1219 UTSW 2 89074992 missense possibly damaging 0.78
R2421:Olfr1219 UTSW 2 89074992 missense possibly damaging 0.78
R3438:Olfr1219 UTSW 2 89074363 missense probably benign 0.08
R4470:Olfr1219 UTSW 2 89075038 missense probably benign 0.01
R4607:Olfr1219 UTSW 2 89074312 missense probably benign 0.08
R4608:Olfr1219 UTSW 2 89074312 missense probably benign 0.08
R4693:Olfr1219 UTSW 2 89075068 missense possibly damaging 0.69
R5382:Olfr1219 UTSW 2 89074735 missense probably damaging 1.00
R5460:Olfr1219 UTSW 2 89074864 missense probably benign 0.00
R5504:Olfr1219 UTSW 2 89074680 missense probably benign 0.00
R6053:Olfr1219 UTSW 2 89074554 missense probably damaging 1.00
R7323:Olfr1219 UTSW 2 89074467 missense probably damaging 0.99
R7606:Olfr1219 UTSW 2 89075297 start gained probably benign
R8229:Olfr1219 UTSW 2 89075038 missense possibly damaging 0.88
T0722:Olfr1219 UTSW 2 89074959 missense probably benign 0.07
Z1176:Olfr1219 UTSW 2 89074438 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGGATTTAGCAATGGTGTAAGGAC -3'
(R):5'- TTCCATCATGACTCGGAGGC -3'

Sequencing Primer
(F):5'- TTATATGGGACCCACAGG -3'
(R):5'- CATCATGACTCGGAGGCTCTGTG -3'
Posted On2019-05-13