Mutagenetix > Incidental Mutation

Incidental Mutation 'R7057:Golga3'

547975

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

045154-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110188663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 389 (S389R)

Ref Sequence

ENSEMBL: ENSMUSP00000031477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512] [ENSMUST00000139611]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031477
AA Change: S389R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: S389R

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112512
AA Change: S349R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: S349R

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139611

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	T	A	6: 40,968,247	V220D	probably benign	Het
Ankrd1	T	C	19: 36,118,233	E113G	possibly damaging	Het
Aqp12	T	C	1: 93,011,996	L249P	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,980	F15S	possibly damaging	Het
Bub1	T	A	2: 127,829,527	M46L	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C2cd4d	A	G	3: 94,363,493	H22R	probably benign	Het
Ccdc157	A	G	11: 4,144,586	V480A	probably benign	Het
Cdc42ep3	G	A	17: 79,335,523		probably benign	Het
Cela1	T	A	15: 100,682,893	T161S	possibly damaging	Het
Chtf18	G	T	17: 25,721,126	A697E	possibly damaging	Het
Cr2	T	C	1: 195,151,610	D957G	possibly damaging	Het
Cyp2c40	A	G	19: 39,807,619	V60A	probably damaging	Het
Dazl	CCATGATGGCGGC	CC	17: 50,293,406		probably null	Het
Dock2	A	T	11: 34,227,684	L1824Q	probably benign	Het
Dock2	T	C	11: 34,695,217	Y546C	probably benign	Het
Fam208a	A	T	14: 27,461,651	N689I	probably damaging	Het
Focad	G	A	4: 88,274,105	C557Y	unknown	Het
Ftmt	T	A	18: 52,332,108	N165K	probably benign	Het
Gen1	A	C	12: 11,242,418	S457A	probably benign	Het
Gja1	T	G	10: 56,388,033	S163A	probably benign	Het
Gm8267	T	C	14: 44,722,024	I194M	probably damaging	Het
Gpc5	C	A	14: 115,133,242	Q87K	possibly damaging	Het
Hmcn2	G	A	2: 31,422,649	A3420T	probably damaging	Het
Htt	A	G	5: 34,821,723	S817G	probably null	Het
Hus1b	C	T	13: 30,947,550	C42Y	possibly damaging	Het
Iars2	A	G	1: 185,289,367	F913L	probably benign	Het
Kcna4	A	G	2: 107,295,320	E133G	probably damaging	Het
Klhl36	T	C	8: 119,876,797	L597P	probably benign	Het
Ltv1	T	C	10: 13,180,902	E299G	possibly damaging	Het
Mmp12	A	G	9: 7,357,840	Y348C	probably damaging	Het
Mmp12	G	A	9: 7,369,173	V270I	probably benign	Het
Mmp2	A	G	8: 92,831,705	D134G	probably damaging	Het
Mrpl15	A	T	1: 4,776,642	M237K	probably benign	Het
Ms4a6b	G	T	19: 11,526,889	V177F	possibly damaging	Het
Muc16	A	G	9: 18,646,079	S2973P	unknown	Het
Olfr1219	A	C	2: 89,074,464	I209S	possibly damaging	Het
Olfr1445	A	T	19: 12,884,642	I254F	probably damaging	Het
Olfr1477	G	T	19: 13,502,879	D179Y	probably damaging	Het
Olfr390	A	C	11: 73,787,148	D70A	possibly damaging	Het
Olfr912	A	T	9: 38,581,754	H159L	probably damaging	Het
Pikfyve	T	A	1: 65,247,205	I1201K	probably benign	Het
Plekhn1	T	G	4: 156,233,917	M83L	probably damaging	Het
Pnlip	G	T	19: 58,676,263	D212Y	probably damaging	Het
Pomt2	T	C	12: 87,127,378	N417S	probably damaging	Het
Pxylp1	T	A	9: 96,825,050	M360L	probably benign	Het
Rbak	G	A	5: 143,173,927	T457I	possibly damaging	Het
Runx2	A	T	17: 44,814,537	W31R	probably null	Het
Sec16a	T	A	2: 26,425,265	I1795F	probably damaging	Het
Sik2	A	T	9: 50,998,561	I64N	probably damaging	Het
Slc26a8	T	C	17: 28,638,397	E924G	possibly damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Slc45a4	C	A	15: 73,587,638	D174Y	probably damaging	Het
Slc6a6	A	C	6: 91,741,267	E354A	probably damaging	Het
Slc8a1	A	T	17: 81,649,095	S171R	probably damaging	Het
Srgap1	T	C	10: 121,804,953	I669M	probably benign	Het
Stk39	C	A	2: 68,410,127	A87S	possibly damaging	Het
Tbx18	C	A	9: 87,705,264	S600I	possibly damaging	Het
Tesc	A	C	5: 118,054,960	K114Q	probably damaging	Het
Tll1	T	C	8: 64,101,881	D256G	probably damaging	Het
Tmem35b	T	A	4: 127,127,886	I45K	probably benign	Het
Tnks	T	C	8: 34,840,014	D1127G	probably damaging	Het
Trpm8	A	T	1: 88,362,080	D920V	probably null	Het
U2af1	A	T	17: 31,648,857	D79E	probably benign	Het
Zfp704	T	C	3: 9,470,917	D331G	probably damaging	Het
Znrf3	G	T	11: 5,282,442	P261Q	probably benign	Het
Zscan4b	A	T	7: 10,901,709	C202*	probably null	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- CTTCTGTAGGAGGCATGAACC -3'
(R):5'- GCAAAGACCCACATACTCTTTTCAG -3'

Sequencing Primer
(F):5'- CAGTCTGGACTACATAGATTCAGGTC -3'
(R):5'- TCAGAGATTCAGTTTATTGAGCAAC -3'

Posted On

2019-05-13