Incidental Mutation 'R7057:Klhl36'
ID547985
Institutional Source Beutler Lab
Gene Symbol Klhl36
Ensembl Gene ENSMUSG00000031828
Gene Namekelch-like 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location119862266-119876995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119876797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 597 (L597P)
Ref Sequence ENSEMBL: ENSMUSP00000034287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034287]
Predicted Effect probably benign
Transcript: ENSMUST00000034287
AA Change: L597P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034287
Gene: ENSMUSG00000031828
AA Change: L597P

DomainStartEndE-ValueType
BTB 45 142 2.05e-26 SMART
BACK 147 249 1.76e-15 SMART
Kelch 294 343 7.59e-2 SMART
Kelch 344 395 6.67e-5 SMART
Kelch 396 442 2.86e-4 SMART
Kelch 443 491 2.86e-4 SMART
Kelch 492 544 2.23e-1 SMART
Kelch 545 593 1.81e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Klhl36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Klhl36 APN 8 119870016 missense possibly damaging 0.92
IGL02310:Klhl36 APN 8 119869617 splice site probably null
IGL02952:Klhl36 APN 8 119870484 missense probably benign 0.01
IGL03027:Klhl36 APN 8 119876490 missense probably benign 0.33
R0440:Klhl36 UTSW 8 119876551 missense probably damaging 1.00
R1918:Klhl36 UTSW 8 119876724 missense probably damaging 1.00
R2141:Klhl36 UTSW 8 119876772 missense possibly damaging 0.94
R2762:Klhl36 UTSW 8 119869974 missense probably damaging 1.00
R4184:Klhl36 UTSW 8 119874385 missense probably damaging 0.99
R6268:Klhl36 UTSW 8 119870667 missense probably damaging 0.98
R6899:Klhl36 UTSW 8 119870142 missense probably benign
R7152:Klhl36 UTSW 8 119870214 missense probably benign 0.13
R7431:Klhl36 UTSW 8 119870382 missense probably benign 0.00
R7438:Klhl36 UTSW 8 119870175 nonsense probably null
R7751:Klhl36 UTSW 8 119869658 missense probably benign 0.08
R7883:Klhl36 UTSW 8 119874478 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACAGCATCTACTCCATCGGG -3'
(R):5'- GAGGGCCCTGATGTAAGTATTCAAAC -3'

Sequencing Primer
(F):5'- ATGGAGTCCATGGAGCGCTTC -3'
(R):5'- TACAAAAAGCTGCTGGAGG -3'
Posted On2019-05-13