Incidental Mutation 'R7057:Mmp12'
ID547987
Institutional Source Beutler Lab
Gene Symbol Mmp12
Ensembl Gene ENSMUSG00000049723
Gene Namematrix metallopeptidase 12
SynonymsMmel, macrophage elastase, MMP12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location7344381-7369499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7369173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 270 (V270I)
Ref Sequence ENSEMBL: ENSMUSP00000065291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047888] [ENSMUST00000065079]
Predicted Effect silent
Transcript: ENSMUST00000047888
SMART Domains Protein: ENSMUSP00000047261
Gene: ENSMUSG00000041620

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 26 84 1.4e-13 PFAM
ZnMc 102 260 3.08e-46 SMART
HX 281 323 4.39e-2 SMART
HX 325 369 3.51e-10 SMART
HX 374 421 1.03e-16 SMART
HX 423 463 1.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065079
AA Change: V270I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723
AA Change: V270I

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein have a diminished capacity to degrade extracellular matrix components, do not develop emphysema in response to long-term exposure to cigarette smoke, and exhibit impaired clearance and increased mortality upon bacterial infection. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to cigarette smoke, decreased littler size, abnormal myelination, abnormal macrophage physiology, and decreased oligodedrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Mmp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mmp12 APN 9 7358307 missense possibly damaging 0.57
IGL03047:Mmp12 APN 9 7357797 splice site probably benign
IGL03224:Mmp12 APN 9 7350002 unclassified probably benign
IGL03247:Mmp12 APN 9 7348631 missense probably benign 0.05
R0050:Mmp12 UTSW 9 7350152 unclassified probably benign
R0480:Mmp12 UTSW 9 7350016 missense probably damaging 1.00
R0729:Mmp12 UTSW 9 7358290 missense possibly damaging 0.82
R0800:Mmp12 UTSW 9 7357827 missense possibly damaging 0.74
R1114:Mmp12 UTSW 9 7358289 missense possibly damaging 0.69
R1441:Mmp12 UTSW 9 7354787 missense probably damaging 0.98
R1765:Mmp12 UTSW 9 7354772 missense probably damaging 1.00
R2071:Mmp12 UTSW 9 7349725 missense probably damaging 1.00
R2102:Mmp12 UTSW 9 7349802 missense probably damaging 1.00
R2882:Mmp12 UTSW 9 7358236 missense probably damaging 1.00
R2936:Mmp12 UTSW 9 7357819 missense probably benign
R4645:Mmp12 UTSW 9 7347515 missense probably benign 0.04
R5210:Mmp12 UTSW 9 7349729 nonsense probably null
R5499:Mmp12 UTSW 9 7353000 missense probably benign 0.02
R5774:Mmp12 UTSW 9 7354823 missense possibly damaging 0.84
R5778:Mmp12 UTSW 9 7350106 missense probably damaging 1.00
R5841:Mmp12 UTSW 9 7347501 missense possibly damaging 0.93
R5869:Mmp12 UTSW 9 7348446 intron probably benign
R6044:Mmp12 UTSW 9 7350050 missense possibly damaging 0.94
R6494:Mmp12 UTSW 9 7353479 missense probably damaging 0.99
R6651:Mmp12 UTSW 9 7355345 missense possibly damaging 0.62
R7057:Mmp12 UTSW 9 7357840 missense probably damaging 1.00
X0062:Mmp12 UTSW 9 7353013 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGCCCAGGATAGCAAGAC -3'
(R):5'- AGGACACTGTTCTAGCTTGTG -3'

Sequencing Primer
(F):5'- GCAAGACAGGCTTATTGGATTCCC -3'
(R):5'- CAAGGAGGGTCATCTGTGGC -3'
Posted On2019-05-13