Incidental Mutation 'R7057:Muc16'
ID 547988
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
MMRRC Submission 045154-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R7057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18646079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2973 (S2973P)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: S2973P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 (GRCm38) V220D probably benign Het
Ankrd1 T C 19: 36,118,233 (GRCm38) E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 (GRCm38) L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 (GRCm38) F15S possibly damaging Het
Bub1 T A 2: 127,829,527 (GRCm38) M46L probably benign Het
C1ra G A 6: 124,517,725 (GRCm38) E316K probably benign Het
C2cd4d A G 3: 94,363,493 (GRCm38) H22R probably benign Het
Ccdc157 A G 11: 4,144,586 (GRCm38) V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 (GRCm38) probably benign Het
Cela1 T A 15: 100,682,893 (GRCm38) T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 (GRCm38) A697E possibly damaging Het
Cr2 T C 1: 195,151,610 (GRCm38) D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 (GRCm38) V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 (GRCm38) probably null Het
Dock2 T C 11: 34,695,217 (GRCm38) Y546C probably benign Het
Dock2 A T 11: 34,227,684 (GRCm38) L1824Q probably benign Het
Focad G A 4: 88,274,105 (GRCm38) C557Y unknown Het
Ftmt T A 18: 52,332,108 (GRCm38) N165K probably benign Het
Gen1 A C 12: 11,242,418 (GRCm38) S457A probably benign Het
Gja1 T G 10: 56,388,033 (GRCm38) S163A probably benign Het
Gm8267 T C 14: 44,722,024 (GRCm38) I194M probably damaging Het
Golga3 T A 5: 110,188,663 (GRCm38) S389R probably damaging Het
Gpc5 C A 14: 115,133,242 (GRCm38) Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 (GRCm38) A3420T probably damaging Het
Htt A G 5: 34,821,723 (GRCm38) S817G probably null Het
Hus1b C T 13: 30,947,550 (GRCm38) C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 (GRCm38) F913L probably benign Het
Kcna4 A G 2: 107,295,320 (GRCm38) E133G probably damaging Het
Klhl36 T C 8: 119,876,797 (GRCm38) L597P probably benign Het
Ltv1 T C 10: 13,180,902 (GRCm38) E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 (GRCm38) Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 (GRCm38) V270I probably benign Het
Mmp2 A G 8: 92,831,705 (GRCm38) D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 (GRCm38) M237K probably benign Het
Ms4a6b G T 19: 11,526,889 (GRCm38) V177F possibly damaging Het
Or1e30 A C 11: 73,787,148 (GRCm38) D70A possibly damaging Het
Or4c114 A C 2: 89,074,464 (GRCm38) I209S possibly damaging Het
Or5b120 G T 19: 13,502,879 (GRCm38) D179Y probably damaging Het
Or5b12b A T 19: 12,884,642 (GRCm38) I254F probably damaging Het
Or8b48 A T 9: 38,581,754 (GRCm38) H159L probably damaging Het
Pikfyve T A 1: 65,247,205 (GRCm38) I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 (GRCm38) M83L probably damaging Het
Pnlip G T 19: 58,676,263 (GRCm38) D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 (GRCm38) N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 (GRCm38) M360L probably benign Het
Rbak G A 5: 143,173,927 (GRCm38) T457I possibly damaging Het
Runx2 A T 17: 44,814,537 (GRCm38) W31R probably null Het
Sec16a T A 2: 26,425,265 (GRCm38) I1795F probably damaging Het
Sik2 A T 9: 50,998,561 (GRCm38) I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 (GRCm38) E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 (GRCm38) R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 (GRCm38) D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 (GRCm38) E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 (GRCm38) S171R probably damaging Het
Srgap1 T C 10: 121,804,953 (GRCm38) I669M probably benign Het
Stk39 C A 2: 68,410,127 (GRCm38) A87S possibly damaging Het
Tasor A T 14: 27,461,651 (GRCm38) N689I probably damaging Het
Tbx18 C A 9: 87,705,264 (GRCm38) S600I possibly damaging Het
Tesc A C 5: 118,054,960 (GRCm38) K114Q probably damaging Het
Tll1 T C 8: 64,101,881 (GRCm38) D256G probably damaging Het
Tmem35b T A 4: 127,127,886 (GRCm38) I45K probably benign Het
Tnks T C 8: 34,840,014 (GRCm38) D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 (GRCm38) D920V probably null Het
U2af1 A T 17: 31,648,857 (GRCm38) D79E probably benign Het
Zfp704 T C 3: 9,470,917 (GRCm38) D331G probably damaging Het
Znrf3 G T 11: 5,282,442 (GRCm38) P261Q probably benign Het
Zscan4b A T 7: 10,901,709 (GRCm38) C202* probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,508,507 (GRCm38) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,495,543 (GRCm38) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,498,700 (GRCm38) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,498,553 (GRCm38) critical splice donor site probably null
Brimming UTSW 9 18,592,680 (GRCm38) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,620,468 (GRCm38) missense probably damaging 0.99
Runneymeade UTSW 9 18,579,317 (GRCm38) critical splice donor site probably null
slimey UTSW 9 18,590,698 (GRCm38) missense probably damaging 1.00
viscous UTSW 9 18,644,732 (GRCm38) missense unknown
R0400:Muc16 UTSW 9 18,510,534 (GRCm38) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,510,477 (GRCm38) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,497,433 (GRCm38) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,497,830 (GRCm38) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,647,146 (GRCm38) missense unknown
R5990:Muc16 UTSW 9 18,659,243 (GRCm38) missense unknown
R6024:Muc16 UTSW 9 18,646,671 (GRCm38) missense unknown
R6026:Muc16 UTSW 9 18,659,858 (GRCm38) missense unknown
R6028:Muc16 UTSW 9 18,657,176 (GRCm38) missense unknown
R6083:Muc16 UTSW 9 18,657,212 (GRCm38) missense unknown
R6089:Muc16 UTSW 9 18,643,252 (GRCm38) missense unknown
R6109:Muc16 UTSW 9 18,655,359 (GRCm38) missense unknown
R6127:Muc16 UTSW 9 18,657,878 (GRCm38) missense unknown
R6130:Muc16 UTSW 9 18,590,698 (GRCm38) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,497,797 (GRCm38) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,647,818 (GRCm38) missense unknown
R6164:Muc16 UTSW 9 18,558,379 (GRCm38) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,654,473 (GRCm38) missense unknown
R6192:Muc16 UTSW 9 18,658,689 (GRCm38) missense unknown
R6217:Muc16 UTSW 9 18,655,446 (GRCm38) missense unknown
R6232:Muc16 UTSW 9 18,656,998 (GRCm38) missense unknown
R6246:Muc16 UTSW 9 18,577,067 (GRCm38) splice site probably null
R6255:Muc16 UTSW 9 18,655,599 (GRCm38) missense unknown
R6280:Muc16 UTSW 9 18,579,317 (GRCm38) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,644,389 (GRCm38) missense unknown
R6287:Muc16 UTSW 9 18,659,034 (GRCm38) missense unknown
R6307:Muc16 UTSW 9 18,647,588 (GRCm38) missense unknown
R6310:Muc16 UTSW 9 18,641,950 (GRCm38) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,641,819 (GRCm38) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,660,708 (GRCm38) missense unknown
R6345:Muc16 UTSW 9 18,654,926 (GRCm38) missense unknown
R6349:Muc16 UTSW 9 18,657,329 (GRCm38) missense unknown
R6366:Muc16 UTSW 9 18,646,044 (GRCm38) missense unknown
R6393:Muc16 UTSW 9 18,647,399 (GRCm38) nonsense probably null
R6440:Muc16 UTSW 9 18,641,359 (GRCm38) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,641,721 (GRCm38) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,640,516 (GRCm38) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,550,677 (GRCm38) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,637,325 (GRCm38) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,562,562 (GRCm38) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,566,715 (GRCm38) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,637,570 (GRCm38) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,609,476 (GRCm38) splice site probably null
R6615:Muc16 UTSW 9 18,647,188 (GRCm38) missense unknown
R6625:Muc16 UTSW 9 18,660,278 (GRCm38) missense unknown
R6668:Muc16 UTSW 9 18,640,385 (GRCm38) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,641,291 (GRCm38) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,642,070 (GRCm38) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,566,690 (GRCm38) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,559,986 (GRCm38) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,537,910 (GRCm38) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,658,769 (GRCm38) nonsense probably null
R6894:Muc16 UTSW 9 18,495,576 (GRCm38) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,642,663 (GRCm38) missense unknown
R6919:Muc16 UTSW 9 18,660,299 (GRCm38) missense unknown
R6939:Muc16 UTSW 9 18,638,537 (GRCm38) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,640,529 (GRCm38) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,645,026 (GRCm38) missense unknown
R6977:Muc16 UTSW 9 18,645,337 (GRCm38) missense unknown
R6996:Muc16 UTSW 9 18,645,897 (GRCm38) missense unknown
R7011:Muc16 UTSW 9 18,637,543 (GRCm38) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,637,451 (GRCm38) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,495,618 (GRCm38) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,658,236 (GRCm38) missense unknown
R7021:Muc16 UTSW 9 18,550,831 (GRCm38) splice site probably null
R7021:Muc16 UTSW 9 18,554,919 (GRCm38) missense unknown
R7038:Muc16 UTSW 9 18,620,468 (GRCm38) missense probably damaging 0.99
R7058:Muc16 UTSW 9 18,639,755 (GRCm38) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,658,021 (GRCm38) missense unknown
R7067:Muc16 UTSW 9 18,658,251 (GRCm38) missense unknown
R7070:Muc16 UTSW 9 18,645,923 (GRCm38) nonsense probably null
R7074:Muc16 UTSW 9 18,655,650 (GRCm38) missense unknown
R7085:Muc16 UTSW 9 18,644,849 (GRCm38) missense unknown
R7088:Muc16 UTSW 9 18,592,680 (GRCm38) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,637,298 (GRCm38) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,655,233 (GRCm38) missense unknown
R7126:Muc16 UTSW 9 18,641,216 (GRCm38) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,643,004 (GRCm38) missense unknown
R7145:Muc16 UTSW 9 18,655,580 (GRCm38) missense unknown
R7179:Muc16 UTSW 9 18,642,008 (GRCm38) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,674,454 (GRCm38) missense unknown
R7211:Muc16 UTSW 9 18,498,570 (GRCm38) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,641,416 (GRCm38) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,644,076 (GRCm38) nonsense probably null
R7221:Muc16 UTSW 9 18,642,199 (GRCm38) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,656,472 (GRCm38) missense unknown
R7326:Muc16 UTSW 9 18,585,013 (GRCm38) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,643,020 (GRCm38) missense unknown
R7387:Muc16 UTSW 9 18,641,720 (GRCm38) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,639,536 (GRCm38) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,637,742 (GRCm38) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,641,962 (GRCm38) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,607,993 (GRCm38) missense
R7484:Muc16 UTSW 9 18,646,768 (GRCm38) missense unknown
R7487:Muc16 UTSW 9 18,584,799 (GRCm38) missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18,645,089 (GRCm38) missense unknown
R7515:Muc16 UTSW 9 18,639,662 (GRCm38) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,638,135 (GRCm38) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,655,451 (GRCm38) missense unknown
R7538:Muc16 UTSW 9 18,642,131 (GRCm38) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,644,732 (GRCm38) missense unknown
R7566:Muc16 UTSW 9 18,638,629 (GRCm38) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,645,614 (GRCm38) missense unknown
R7594:Muc16 UTSW 9 18,645,062 (GRCm38) missense unknown
R7629:Muc16 UTSW 9 18,566,785 (GRCm38) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,607,722 (GRCm38) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,558,427 (GRCm38) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,605,282 (GRCm38) missense
R7727:Muc16 UTSW 9 18,660,242 (GRCm38) missense unknown
R7743:Muc16 UTSW 9 18,657,477 (GRCm38) missense unknown
R7744:Muc16 UTSW 9 18,585,096 (GRCm38) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,580,574 (GRCm38) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,660,507 (GRCm38) missense unknown
R7805:Muc16 UTSW 9 18,638,493 (GRCm38) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,595,223 (GRCm38) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,640,773 (GRCm38) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,640,505 (GRCm38) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,642,694 (GRCm38) missense unknown
R7885:Muc16 UTSW 9 18,639,464 (GRCm38) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,585,982 (GRCm38) missense probably benign 0.03
R7899:Muc16 UTSW 9 18,640,697 (GRCm38) missense probably benign 0.01
R7904:Muc16 UTSW 9 18,655,650 (GRCm38) missense unknown
R7921:Muc16 UTSW 9 18,659,318 (GRCm38) missense unknown
R7922:Muc16 UTSW 9 18,584,825 (GRCm38) missense probably benign 0.16
R7948:Muc16 UTSW 9 18,642,490 (GRCm38) missense unknown
R7957:Muc16 UTSW 9 18,643,471 (GRCm38) missense unknown
R7972:Muc16 UTSW 9 18,645,764 (GRCm38) nonsense probably null
R7992:Muc16 UTSW 9 18,656,429 (GRCm38) missense unknown
R7998:Muc16 UTSW 9 18,639,892 (GRCm38) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,654,875 (GRCm38) missense unknown
R8033:Muc16 UTSW 9 18,636,606 (GRCm38) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,659,051 (GRCm38) missense unknown
R8058:Muc16 UTSW 9 18,660,002 (GRCm38) nonsense probably null
R8088:Muc16 UTSW 9 18,519,300 (GRCm38) nonsense probably null
R8095:Muc16 UTSW 9 18,584,830 (GRCm38) nonsense probably null
R8111:Muc16 UTSW 9 18,592,629 (GRCm38) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,658,737 (GRCm38) missense unknown
R8117:Muc16 UTSW 9 18,508,910 (GRCm38) nonsense probably null
R8137:Muc16 UTSW 9 18,645,676 (GRCm38) missense unknown
R8196:Muc16 UTSW 9 18,645,334 (GRCm38) missense unknown
R8218:Muc16 UTSW 9 18,637,019 (GRCm38) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,642,977 (GRCm38) missense unknown
R8313:Muc16 UTSW 9 18,525,147 (GRCm38) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,658,043 (GRCm38) missense unknown
R8342:Muc16 UTSW 9 18,658,685 (GRCm38) missense unknown
R8351:Muc16 UTSW 9 18,659,885 (GRCm38) missense unknown
R8356:Muc16 UTSW 9 18,658,778 (GRCm38) missense unknown
R8360:Muc16 UTSW 9 18,525,258 (GRCm38) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,519,630 (GRCm38) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,537,511 (GRCm38) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,657,924 (GRCm38) missense unknown
R8463:Muc16 UTSW 9 18,659,139 (GRCm38) missense unknown
R8466:Muc16 UTSW 9 18,643,148 (GRCm38) missense unknown
R8512:Muc16 UTSW 9 18,638,192 (GRCm38) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,519,631 (GRCm38) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,640,937 (GRCm38) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,646,448 (GRCm38) missense unknown
R8680:Muc16 UTSW 9 18,644,719 (GRCm38) missense unknown
R8720:Muc16 UTSW 9 18,641,600 (GRCm38) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,660,050 (GRCm38) missense unknown
R8736:Muc16 UTSW 9 18,550,843 (GRCm38) nonsense probably null
R8739:Muc16 UTSW 9 18,637,298 (GRCm38) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,656,057 (GRCm38) missense unknown
R8830:Muc16 UTSW 9 18,646,069 (GRCm38) missense unknown
R8871:Muc16 UTSW 9 18,656,048 (GRCm38) missense unknown
R8884:Muc16 UTSW 9 18,644,200 (GRCm38) missense unknown
R8923:Muc16 UTSW 9 18,638,676 (GRCm38) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,647,233 (GRCm38) missense unknown
R8949:Muc16 UTSW 9 18,520,925 (GRCm38) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,551,685 (GRCm38) nonsense probably null
R8997:Muc16 UTSW 9 18,607,467 (GRCm38) intron probably benign
R9013:Muc16 UTSW 9 18,512,773 (GRCm38) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,638,719 (GRCm38) small insertion probably benign
R9036:Muc16 UTSW 9 18,644,679 (GRCm38) missense unknown
R9040:Muc16 UTSW 9 18,644,786 (GRCm38) nonsense probably null
R9065:Muc16 UTSW 9 18,643,009 (GRCm38) missense unknown
R9089:Muc16 UTSW 9 18,644,550 (GRCm38) missense unknown
R9098:Muc16 UTSW 9 18,643,679 (GRCm38) missense unknown
R9100:Muc16 UTSW 9 18,645,670 (GRCm38) missense unknown
R9128:Muc16 UTSW 9 18,647,582 (GRCm38) missense unknown
R9169:Muc16 UTSW 9 18,656,528 (GRCm38) missense unknown
R9180:Muc16 UTSW 9 18,642,742 (GRCm38) missense unknown
R9191:Muc16 UTSW 9 18,644,810 (GRCm38) missense unknown
R9203:Muc16 UTSW 9 18,551,688 (GRCm38) missense unknown
R9208:Muc16 UTSW 9 18,508,537 (GRCm38) missense probably damaging 0.99
R9232:Muc16 UTSW 9 18,656,040 (GRCm38) missense unknown
R9240:Muc16 UTSW 9 18,538,013 (GRCm38) missense unknown
R9254:Muc16 UTSW 9 18,646,171 (GRCm38) missense unknown
R9330:Muc16 UTSW 9 18,641,036 (GRCm38) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,660,215 (GRCm38) missense unknown
R9358:Muc16 UTSW 9 18,642,224 (GRCm38) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,537,764 (GRCm38) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,646,171 (GRCm38) missense unknown
R9403:Muc16 UTSW 9 18,537,764 (GRCm38) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,641,806 (GRCm38) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,572,641 (GRCm38) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,647,732 (GRCm38) missense unknown
R9442:Muc16 UTSW 9 18,655,328 (GRCm38) missense unknown
R9453:Muc16 UTSW 9 18,660,765 (GRCm38) missense unknown
R9467:Muc16 UTSW 9 18,597,035 (GRCm38) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,656,853 (GRCm38) nonsense probably null
R9519:Muc16 UTSW 9 18,586,920 (GRCm38) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,586,018 (GRCm38) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,658,638 (GRCm38) missense unknown
R9583:Muc16 UTSW 9 18,638,677 (GRCm38) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,655,851 (GRCm38) missense unknown
R9638:Muc16 UTSW 9 18,639,330 (GRCm38) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,642,466 (GRCm38) missense unknown
R9652:Muc16 UTSW 9 18,586,882 (GRCm38) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,655,989 (GRCm38) missense unknown
R9682:Muc16 UTSW 9 18,642,578 (GRCm38) missense unknown
R9765:Muc16 UTSW 9 18,637,198 (GRCm38) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,641,087 (GRCm38) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,636,857 (GRCm38) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,659,379 (GRCm38) missense unknown
R9782:Muc16 UTSW 9 18,636,770 (GRCm38) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,657,861 (GRCm38) nonsense probably null
Z1177:Muc16 UTSW 9 18,537,571 (GRCm38) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGCTGCCTTAGTAGACTTGG -3'
(R):5'- CCTCATTGGTGACTCATGCAG -3'

Sequencing Primer
(F):5'- CTTGGAAAAACTGGACTGTGTC -3'
(R):5'- AAGCAACTTTGGGGGTTTTACCTAC -3'
Posted On 2019-05-13