Incidental Mutation 'R7057:Tbx18'
ID547991
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene NameT-box18
Synonyms2810404D13Rik, 2810012F10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location87702800-87731260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87705264 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 600 (S600I)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034991
AA Change: S600I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S600I

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87705623 missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87705661 missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87724331 missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87713543 missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87724408 missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87707859 missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87727406 missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87730829 missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87705580 missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87729653 missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87715516 splice site probably benign
R0374:Tbx18 UTSW 9 87724355 missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87724409 missense probably benign 0.13
R2141:Tbx18 UTSW 9 87715653 missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87705736 missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87729636 missense probably benign
R4214:Tbx18 UTSW 9 87724465 missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87730769 missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87727449 missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87715687 missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87713513 missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87715535 nonsense probably null
R6659:Tbx18 UTSW 9 87707811 missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87727404 missense probably damaging 1.00
R7167:Tbx18 UTSW 9 87707830 missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87730697 missense probably benign
R8147:Tbx18 UTSW 9 87724358 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGCCAATACTCTGTGGAACTG -3'
(R):5'- ACAGTCCCTGTGCCTTGTATG -3'

Sequencing Primer
(F):5'- CGCCAATACTCTGTGGAACTGAATAG -3'
(R):5'- GTCCCTGTGCCTTGTATGGATATAAC -3'
Posted On2019-05-13