Incidental Mutation 'R7057:Srgap1'
ID547995
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121804953 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 669 (I669M)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688] [ENSMUST00000161156]
Predicted Effect probably benign
Transcript: ENSMUST00000020322
AA Change: I646M

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: I646M

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081688
AA Change: I669M

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: I669M

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161156
SMART Domains Protein: ENSMUSP00000125109
Gene: ENSMUSG00000020121

DomainStartEndE-ValueType
Pfam:RhoGAP 1 68 2.6e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6807:Srgap1 UTSW 10 121828726 splice site probably null
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
R7196:Srgap1 UTSW 10 121840848 missense probably benign 0.00
R7247:Srgap1 UTSW 10 121869790 missense probably damaging 0.98
R7404:Srgap1 UTSW 10 121785745 missense probably benign 0.18
R7467:Srgap1 UTSW 10 121855439 nonsense probably null
R7792:Srgap1 UTSW 10 121925967 missense probably damaging 0.98
R7846:Srgap1 UTSW 10 121785492 missense probably damaging 0.97
R7896:Srgap1 UTSW 10 121853553 critical splice donor site probably benign
R7912:Srgap1 UTSW 10 121853553 critical splice donor site probably benign
R8127:Srgap1 UTSW 10 121855366 missense probably null 0.04
R8233:Srgap1 UTSW 10 121825436 missense probably damaging 1.00
R8248:Srgap1 UTSW 10 121804817 missense probably damaging 0.99
R8362:Srgap1 UTSW 10 121855478 missense possibly damaging 0.46
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGATGGAGGGCTCTGTTC -3'
(R):5'- GCCAGCTCTAAGTATGATGGG -3'

Sequencing Primer
(F):5'- AGGGCTCTGTTCTTGGACTCAC -3'
(R):5'- CTATAACTCCAGCTTCAGGGG -3'
Posted On2019-05-13