Incidental Mutation 'R7057:Cela1'
ID548008
Institutional Source Beutler Lab
Gene Symbol Cela1
Ensembl Gene ENSMUSG00000023031
Gene Namechymotrypsin-like elastase family, member 1
Synonyms1810062B19Rik, Ela1, Ela-1, 1810009A17Rik, PC-TsF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100674421-100687921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100682893 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 161 (T161S)
Ref Sequence ENSEMBL: ENSMUSP00000023775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023775] [ENSMUST00000229869] [ENSMUST00000230572] [ENSMUST00000230740] [ENSMUST00000230744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023775
AA Change: T161S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023775
Gene: ENSMUSG00000023031
AA Change: T161S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 26 259 1.24e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229869
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000230572
Predicted Effect probably benign
Transcript: ENSMUST00000230740
Predicted Effect probably benign
Transcript: ENSMUST00000230744
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Cela1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Cela1 UTSW 15 100685167 missense probably benign 0.43
R2060:Cela1 UTSW 15 100675322 critical splice donor site probably null
R2358:Cela1 UTSW 15 100681228 missense probably benign
R3968:Cela1 UTSW 15 100684653 missense probably damaging 1.00
R4236:Cela1 UTSW 15 100682913 missense probably damaging 1.00
R5491:Cela1 UTSW 15 100682980 missense probably damaging 1.00
R6140:Cela1 UTSW 15 100681156 missense probably benign 0.01
R6378:Cela1 UTSW 15 100687190 missense probably benign 0.00
R7536:Cela1 UTSW 15 100675364 missense probably damaging 1.00
R8152:Cela1 UTSW 15 100682941 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGACTTGATCTTTGGTTCCC -3'
(R):5'- CACATCTAATGTCCAGCAGCTC -3'

Sequencing Primer
(F):5'- CTAGGTCATAGGTCTCAGGCTATAC -3'
(R):5'- CATCATATTGCCTAGAGCTGGAG -3'
Posted On2019-05-13