Incidental Mutation 'R7057:Runx2'
ID548012
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44814537 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 31 (W31R)
Ref Sequence ENSEMBL: ENSMUSP00000123743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000127798] [ENSMUST00000129416] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162629]
Predicted Effect probably benign
Transcript: ENSMUST00000050630
SMART Domains Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 4.5e-38 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113568
AA Change: W31R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000113571
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127798
SMART Domains Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 9.3e-39 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129416
SMART Domains Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
Pfam:TFIID-18kDa 17 109 1e-38 PFAM
low complexity region 267 287 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159943
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160672
Predicted Effect probably null
Transcript: ENSMUST00000160673
AA Change: W31R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: W31R

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162629
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R5526:Runx2 UTSW 17 44724862 missense probably damaging 1.00
R6566:Runx2 UTSW 17 44814488 critical splice donor site probably null
R6874:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6875:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7835:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R7918:Runx2 UTSW 17 44608236 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTATGCCTGGAGTACATAGAC -3'
(R):5'- AGGCAGTCCCACTTTACTTTG -3'

Sequencing Primer
(F):5'- GCTGGTAACATGTGAAAAGC -3'
(R):5'- CCCACTTTACTTTGAGTACTGTGAGG -3'
Posted On2019-05-13