Incidental Mutation 'R7057:Dazl'
ID548013
Institutional Source Beutler Lab
Gene Symbol Dazl
Ensembl Gene ENSMUSG00000010592
Gene Namedeleted in azoospermia-like
SynonymsDaz-like, Tpx2, Dazla, Tpx-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7057 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location50279394-50293599 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) CCATGATGGCGGC to CC at 50293406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010736]
PDB Structure
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH RNA, UUGUUCUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH MVH RNA, UGUUC [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH SYCP3 RNA, UUGUUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000010736
SMART Domains Protein: ENSMUSP00000010736
Gene: ENSMUSG00000010592

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
RRM 41 111 2.16e-19 SMART
low complexity region 125 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit sterility with a complete absence of mature germ cells. In mutants, few spermatogonia enter meiosis, and those that do fail to proceed beyond pachytene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Dazl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Dazl APN 17 50293398 splice site probably benign
R0063:Dazl UTSW 17 152705859 missense probably damaging 1.00
R3801:Dazl UTSW 17 50281281 missense probably benign 0.44
R3961:Dazl UTSW 17 50288133 missense probably damaging 0.99
R4646:Dazl UTSW 17 50288155 missense probably damaging 1.00
R5310:Dazl UTSW 17 50281283 missense probably damaging 1.00
R5389:Dazl UTSW 17 50288690 missense probably benign 0.25
R5933:Dazl UTSW 17 50287753 critical splice donor site probably null
R6173:Dazl UTSW 17 50287571 missense probably benign 0.05
R7523:Dazl UTSW 17 50287541 missense probably damaging 0.97
R8393:Dazl UTSW 17 50281266 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCCCTCAGTGCTGGTGTAG -3'
(R):5'- CCTATTGGCTGTAGCACGTC -3'

Sequencing Primer
(F):5'- AAGGCCGCCACTCTTGTC -3'
(R):5'- TATTGGCTGTAGCACGTCACGAG -3'
Posted On2019-05-13