Incidental Mutation 'R7057:Slc8a1'
ID548015
Institutional Source Beutler Lab
Gene Symbol Slc8a1
Ensembl Gene ENSMUSG00000054640
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 1
SynonymsNcx1, D930008O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location81388691-81649607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81649095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 171 (S171R)
Ref Sequence ENSEMBL: ENSMUSP00000126373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]
Predicted Effect probably damaging
Transcript: ENSMUST00000086538
AA Change: S171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: S171R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163123
AA Change: S171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: S171R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 87 246 4.6e-38 PFAM
coiled coil region 313 332 N/A INTRINSIC
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 742 753 N/A INTRINSIC
Pfam:Na_Ca_ex 794 947 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163680
AA Change: S171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: S171R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Slc8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Slc8a1 APN 17 81649171 missense probably damaging 1.00
IGL00572:Slc8a1 APN 17 81388726 missense probably damaging 1.00
IGL00777:Slc8a1 APN 17 81648580 missense probably damaging 1.00
IGL00857:Slc8a1 APN 17 81647879 missense probably benign 0.03
IGL01068:Slc8a1 APN 17 81388942 missense probably benign 0.09
IGL01089:Slc8a1 APN 17 81648281 missense probably damaging 1.00
IGL01089:Slc8a1 APN 17 81388881 missense probably damaging 1.00
IGL01510:Slc8a1 APN 17 81648365 missense probably damaging 1.00
IGL01677:Slc8a1 APN 17 81648607 missense probably damaging 1.00
IGL01862:Slc8a1 APN 17 81442201 critical splice donor site probably null
IGL02003:Slc8a1 APN 17 81428196 missense possibly damaging 0.80
IGL02500:Slc8a1 APN 17 81388713 missense probably damaging 1.00
IGL02556:Slc8a1 APN 17 81648744 missense probably benign 0.24
IGL02800:Slc8a1 APN 17 81408323 missense probably benign 0.01
IGL03308:Slc8a1 APN 17 81442195 unclassified probably benign
IGL03391:Slc8a1 APN 17 81432638 splice site probably benign
cardinal UTSW 17 81648407 missense probably damaging 0.99
encyclical UTSW 17 81649454 missense probably damaging 1.00
PIT4498001:Slc8a1 UTSW 17 81648840 nonsense probably null
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0485:Slc8a1 UTSW 17 81647993 missense probably damaging 0.99
R0667:Slc8a1 UTSW 17 81648881 missense probably damaging 1.00
R0845:Slc8a1 UTSW 17 81437748 missense probably benign 0.05
R1073:Slc8a1 UTSW 17 81648407 missense probably damaging 0.99
R1417:Slc8a1 UTSW 17 81408280 missense probably damaging 1.00
R1510:Slc8a1 UTSW 17 81648118 missense probably damaging 1.00
R1546:Slc8a1 UTSW 17 81648247 missense probably damaging 1.00
R1625:Slc8a1 UTSW 17 81649241 missense probably damaging 1.00
R1806:Slc8a1 UTSW 17 81648487 missense probably damaging 1.00
R1879:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R2025:Slc8a1 UTSW 17 81649112 missense probably damaging 1.00
R2187:Slc8a1 UTSW 17 81648553 missense possibly damaging 0.48
R2198:Slc8a1 UTSW 17 81408256 nonsense probably null
R3856:Slc8a1 UTSW 17 81648374 missense probably benign
R4067:Slc8a1 UTSW 17 81648274 missense probably damaging 1.00
R4224:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R4225:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R5028:Slc8a1 UTSW 17 81649273 missense possibly damaging 0.91
R5307:Slc8a1 UTSW 17 81649224 missense probably damaging 1.00
R5766:Slc8a1 UTSW 17 81648961 missense probably damaging 0.97
R5787:Slc8a1 UTSW 17 81388737 missense probably damaging 1.00
R5902:Slc8a1 UTSW 17 81408082 missense probably damaging 1.00
R5913:Slc8a1 UTSW 17 81648002 missense probably damaging 1.00
R6017:Slc8a1 UTSW 17 81648254 missense probably damaging 1.00
R6481:Slc8a1 UTSW 17 81388918 missense probably benign
R6670:Slc8a1 UTSW 17 81649454 missense probably damaging 1.00
R6714:Slc8a1 UTSW 17 81408249 missense probably damaging 1.00
R6914:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R6919:Slc8a1 UTSW 17 81388872 missense probably damaging 1.00
R6942:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R7431:Slc8a1 UTSW 17 81441663 missense probably benign 0.00
R7447:Slc8a1 UTSW 17 81649006 missense probably damaging 1.00
R7480:Slc8a1 UTSW 17 81649220 missense probably damaging 1.00
R7572:Slc8a1 UTSW 17 81441771 critical splice donor site probably null
R8056:Slc8a1 UTSW 17 81647923 missense probably damaging 1.00
X0024:Slc8a1 UTSW 17 81432762 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTAAGCAAGCCTTCCCAGAC -3'
(R):5'- TGCAGACCGGTTTATGTCC -3'

Sequencing Primer
(F):5'- GACCTCCACAACTCCAGGAG -3'
(R):5'- CAGACCGGTTTATGTCCTCTATAGAG -3'
Posted On2019-05-13