Incidental Mutation 'R7057:Pnlip'
ID548022
Institutional Source Beutler Lab
Gene Symbol Pnlip
Ensembl Gene ENSMUSG00000046008
Gene Namepancreatic lipase
Synonymspancreatic triglyceride lipase, PTL, 1810007A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location58670365-58681786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58676263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 212 (D212Y)
Ref Sequence ENSEMBL: ENSMUSP00000056377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057270]
Predicted Effect probably damaging
Transcript: ENSMUST00000057270
AA Change: D212Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008
AA Change: D212Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice show impaired dietary cholesterol, triglyceride and retinyl ester absorption, resistance to diet-induced obesity, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Muc16 A G 9: 18,646,079 S2973P unknown Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Pnlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Pnlip APN 19 58673874 missense probably benign 0.00
IGL02733:Pnlip APN 19 58680788 missense probably benign
R1121:Pnlip UTSW 19 58680908 splice site probably null
R2145:Pnlip UTSW 19 58676444 missense probably benign 0.11
R2213:Pnlip UTSW 19 58673770 missense probably benign 0.07
R3405:Pnlip UTSW 19 58680759 missense probably benign
R4703:Pnlip UTSW 19 58676467 missense probably damaging 1.00
R4731:Pnlip UTSW 19 58676487 missense probably benign 0.00
R4909:Pnlip UTSW 19 58676240 missense possibly damaging 0.85
R5386:Pnlip UTSW 19 58679607 missense probably benign 0.25
R5444:Pnlip UTSW 19 58673163 missense probably benign 0.00
R5851:Pnlip UTSW 19 58673792 nonsense probably null
R6515:Pnlip UTSW 19 58673115 missense probably damaging 1.00
R6605:Pnlip UTSW 19 58671742 missense probably benign 0.20
R6974:Pnlip UTSW 19 58679635 critical splice donor site probably null
R7312:Pnlip UTSW 19 58681702 missense probably damaging 0.97
R7358:Pnlip UTSW 19 58676544 missense probably damaging 1.00
R7476:Pnlip UTSW 19 58679634 critical splice donor site probably null
R7674:Pnlip UTSW 19 58675154 missense possibly damaging 0.70
R7800:Pnlip UTSW 19 58681702 missense probably benign 0.18
R7983:Pnlip UTSW 19 58680059 missense probably benign 0.04
X0025:Pnlip UTSW 19 58680810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGTGCCCGACAGTTGACG -3'
(R):5'- AATCTAAGTGACCCACAGTCTG -3'

Sequencing Primer
(F):5'- GCCCGACAGTTGACGAAACAG -3'
(R):5'- TGGCTCATTCCAAATCCTGAAG -3'
Posted On2019-05-13