Incidental Mutation 'R7058:Zdbf2'
ID 548023
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 045155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7058 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63346563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1647 (H1647Q)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: H1647Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: H1647Q

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: H1647Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: H1647Q

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,275,554 (GRCm39) I419T possibly damaging Het
Afap1 T C 5: 36,119,604 (GRCm39) V294A probably benign Het
Amotl1 T A 9: 14,486,532 (GRCm39) Q454L possibly damaging Het
Ap2a1 T C 7: 44,550,215 (GRCm39) S961G probably damaging Het
Asxl3 A G 18: 22,650,731 (GRCm39) K907E probably damaging Het
BC028528 A T 3: 95,792,323 (GRCm39) L137I possibly damaging Het
Cand1 A T 10: 119,047,659 (GRCm39) N610K probably benign Het
Cat A G 2: 103,304,698 (GRCm39) I109T probably benign Het
Ccdc18 T C 5: 108,341,664 (GRCm39) V853A probably benign Het
Chd4 C A 6: 125,085,405 (GRCm39) D805E possibly damaging Het
Cnih1 A C 14: 47,017,652 (GRCm39) F77V probably damaging Het
Cntd1 A T 11: 101,178,252 (GRCm39) I284F probably damaging Het
Col6a3 C A 1: 90,755,759 (GRCm39) E177* probably null Het
Cpxm2 T A 7: 131,745,408 (GRCm39) D139V probably benign Het
Cyp1a2 G T 9: 57,584,525 (GRCm39) R510S probably damaging Het
D2hgdh T C 1: 93,763,096 (GRCm39) S294P probably damaging Het
Dchs1 A G 7: 105,406,228 (GRCm39) C2335R probably benign Het
Disc1 G T 8: 125,977,724 (GRCm39) C719F probably damaging Het
Dnah14 A C 1: 181,525,614 (GRCm39) D2180A probably benign Het
Dop1b G A 16: 93,573,878 (GRCm39) R1582Q probably benign Het
Dsg2 A T 18: 20,725,332 (GRCm39) H481L probably benign Het
Epha6 A G 16: 59,503,013 (GRCm39) S965P probably damaging Het
Esrrg G T 1: 187,882,503 (GRCm39) L253F probably damaging Het
Exoc6b T C 6: 84,831,704 (GRCm39) K438R probably damaging Het
Fam98a C A 17: 75,845,384 (GRCm39) R454L unknown Het
Fam98c A T 7: 28,855,308 (GRCm39) probably null Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Galnt13 A G 2: 54,988,587 (GRCm39) T470A probably damaging Het
Ggt7 A T 2: 155,345,015 (GRCm39) probably null Het
Golim4 T C 3: 75,785,957 (GRCm39) E606G probably damaging Het
Gpd2 G A 2: 57,197,112 (GRCm39) probably null Het
Grin2b T C 6: 135,757,304 (GRCm39) M386V probably damaging Het
Hfm1 A T 5: 107,059,306 (GRCm39) S239T probably benign Het
Hmcn1 G A 1: 150,649,641 (GRCm39) T615I probably benign Het
Hook2 G A 8: 85,724,040 (GRCm39) E446K possibly damaging Het
Hsd3b1 C T 3: 98,765,131 (GRCm39) probably null Het
Igsf9b A G 9: 27,234,150 (GRCm39) Y421C probably damaging Het
Il21 A G 3: 37,286,629 (GRCm39) L29P probably damaging Het
Ildr1 A G 16: 36,542,730 (GRCm39) S421G probably benign Het
Kat2b C A 17: 53,972,894 (GRCm39) T736K probably benign Het
Kcng1 A G 2: 168,104,529 (GRCm39) V439A probably damaging Het
Kif21a A T 15: 90,833,106 (GRCm39) probably null Het
Lat A G 7: 125,968,318 (GRCm39) probably null Het
Mastl T A 2: 23,023,425 (GRCm39) K433* probably null Het
Mettl2 A G 11: 105,019,719 (GRCm39) R119G probably benign Het
Mia2 C T 12: 59,231,021 (GRCm39) P1223L possibly damaging Het
Mkrn2os G T 6: 115,563,635 (GRCm39) D133E probably benign Het
Mslnl A G 17: 25,962,186 (GRCm39) T195A probably benign Het
Muc16 T G 9: 18,551,051 (GRCm39) T5081P probably benign Het
Mylpf G C 7: 126,813,139 (GRCm39) R110P probably damaging Het
Myo19 G T 11: 84,798,194 (GRCm39) C738F possibly damaging Het
Nat8f4 T A 6: 85,878,271 (GRCm39) N84I possibly damaging Het
Nol8 C T 13: 49,829,862 (GRCm39) R1104C probably damaging Het
Notch1 A T 2: 26,353,830 (GRCm39) D1932E probably benign Het
Nsun3 A T 16: 62,596,663 (GRCm39) C152S possibly damaging Het
Opcml G A 9: 28,586,507 (GRCm39) W75* probably null Het
Or14j10 A G 17: 37,934,597 (GRCm39) F310L probably benign Het
Pcdh7 G A 5: 57,879,582 (GRCm39) E1046K probably damaging Het
Pcdhb9 T A 18: 37,536,334 (GRCm39) V776D probably benign Het
Pla2g4a A G 1: 149,727,103 (GRCm39) L551S probably damaging Het
Plaa G A 4: 94,458,060 (GRCm39) Q637* probably null Het
Plekhh1 A T 12: 79,122,204 (GRCm39) E1099V probably damaging Het
Ppp4r1 A T 17: 66,136,495 (GRCm39) N551Y probably benign Het
R3hdm2 T C 10: 127,320,382 (GRCm39) V554A probably damaging Het
Rab44 A G 17: 29,357,150 (GRCm39) probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rasgrf2 T C 13: 92,034,521 (GRCm39) T1119A probably damaging Het
Rims2 A G 15: 39,449,044 (GRCm39) D1194G probably damaging Het
Scarb1 A T 5: 125,374,294 (GRCm39) C280S probably damaging Het
Sde2 T C 1: 180,693,827 (GRCm39) F439S probably damaging Het
Setd5 T C 6: 113,092,532 (GRCm39) I304T probably benign Het
Sipa1l1 A G 12: 82,449,896 (GRCm39) E1106G probably benign Het
Sis T G 3: 72,810,940 (GRCm39) S1694R probably damaging Het
Smad9 T A 3: 54,693,614 (GRCm39) F181Y probably benign Het
Smg1 A G 7: 117,797,502 (GRCm39) probably benign Het
Sspo T C 6: 48,425,516 (GRCm39) Y46H probably damaging Het
Tdrd12 A G 7: 35,177,534 (GRCm39) M940T unknown Het
Tmem44 G T 16: 30,366,213 (GRCm39) T71K possibly damaging Het
Tmf1 T A 6: 97,133,911 (GRCm39) E1009V probably damaging Het
Ttc39a C T 4: 109,288,763 (GRCm39) R288W probably damaging Het
Ttc9c G A 19: 8,796,191 (GRCm39) probably benign Het
Usp28 T A 9: 48,950,456 (GRCm39) Y634N probably damaging Het
Vmn1r211 C T 13: 23,036,063 (GRCm39) M201I probably benign Het
Vmn2r54 T A 7: 12,349,722 (GRCm39) Q620L possibly damaging Het
Vps13c T C 9: 67,831,110 (GRCm39) L1580P probably benign Het
Vrk3 C A 7: 44,417,890 (GRCm39) F308L probably damaging Het
Zfp984 A T 4: 147,840,002 (GRCm39) M283K probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCACCTCAGATGACTGTCAAAG -3'
(R):5'- TTCCGAAGACTGGTGGCTTC -3'

Sequencing Primer
(F):5'- TCAGATGACTGTCAAAGAAACCAGTG -3'
(R):5'- TGGCTTCTCCAGTTTTCTGTAG -3'
Posted On 2019-05-13