Mutagenetix > Incidental Mutation

Incidental Mutation 'R7058:Zdbf2'

548023

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R7058 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63307404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1647 (H1647Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: H1647Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: H1647Q

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: H1647Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: H1647Q

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	C	7: 41,626,130	I419T	possibly damaging	Het
Afap1	T	C	5: 35,962,260	V294A	probably benign	Het
Amotl1	T	A	9: 14,575,236	Q454L	possibly damaging	Het
Ap2a1	T	C	7: 44,900,791	S961G	probably damaging	Het
Asxl3	A	G	18: 22,517,674	K907E	probably damaging	Het
BC028528	A	T	3: 95,885,011	L137I	possibly damaging	Het
Cand1	A	T	10: 119,211,754	N610K	probably benign	Het
Cat	A	G	2: 103,474,353	I109T	probably benign	Het
Ccdc18	T	C	5: 108,193,798	V853A	probably benign	Het
Chd4	C	A	6: 125,108,442	D805E	possibly damaging	Het
Cnih1	A	C	14: 46,780,195	F77V	probably damaging	Het
Cntd1	A	T	11: 101,287,426	I284F	probably damaging	Het
Col6a3	C	A	1: 90,828,037	E177*	probably null	Het
Cpxm2	T	A	7: 132,143,679	D139V	probably benign	Het
Cyp1a2	G	T	9: 57,677,242	R510S	probably damaging	Het
D2hgdh	T	C	1: 93,835,374	S294P	probably damaging	Het
Dchs1	A	G	7: 105,757,021	C2335R	probably benign	Het
Disc1	G	T	8: 125,250,985	C719F	probably damaging	Het
Dnah14	A	C	1: 181,698,049	D2180A	probably benign	Het
Dopey2	G	A	16: 93,776,990	R1582Q	probably benign	Het
Dsg2	A	T	18: 20,592,275	H481L	probably benign	Het
Epha6	A	G	16: 59,682,650	S965P	probably damaging	Het
Esrrg	G	T	1: 188,150,306	L253F	probably damaging	Het
Exoc6b	T	C	6: 84,854,722	K438R	probably damaging	Het
Fam98a	C	A	17: 75,538,389	R454L	unknown	Het
Fam98c	A	T	7: 29,155,883		probably null	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Galnt13	A	G	2: 55,098,575	T470A	probably damaging	Het
Ggt7	A	T	2: 155,503,095		probably null	Het
Golim4	T	C	3: 75,878,650	E606G	probably damaging	Het
Gpd2	G	A	2: 57,307,100		probably null	Het
Grin2b	T	C	6: 135,780,306	M386V	probably damaging	Het
Hfm1	A	T	5: 106,911,440	S239T	probably benign	Het
Hmcn1	G	A	1: 150,773,890	T615I	probably benign	Het
Hook2	G	A	8: 84,997,411	E446K	possibly damaging	Het
Hsd3b1	C	T	3: 98,857,815		probably null	Het
Igsf9b	A	G	9: 27,322,854	Y421C	probably damaging	Het
Il21	A	G	3: 37,232,480	L29P	probably damaging	Het
Ildr1	A	G	16: 36,722,368	S421G	probably benign	Het
Kat2b	C	A	17: 53,665,866	T736K	probably benign	Het
Kcng1	A	G	2: 168,262,609	V439A	probably damaging	Het
Kif21a	A	T	15: 90,948,903		probably null	Het
Lat	A	G	7: 126,369,146		probably null	Het
Mastl	T	A	2: 23,133,413	K433*	probably null	Het
Mettl2	A	G	11: 105,128,893	R119G	probably benign	Het
Mia2	C	T	12: 59,184,235	P1223L	possibly damaging	Het
Mkrn2os	G	T	6: 115,586,674	D133E	probably benign	Het
Mslnl	A	G	17: 25,743,212	T195A	probably benign	Het
Muc16	T	G	9: 18,639,755	T5081P	probably benign	Het
Mylpf	G	C	7: 127,213,967	R110P	probably damaging	Het
Myo19	G	T	11: 84,907,368	C738F	possibly damaging	Het
Nat8f4	T	A	6: 85,901,289	N84I	possibly damaging	Het
Nol8	C	T	13: 49,676,386	R1104C	probably damaging	Het
Notch1	A	T	2: 26,463,818	D1932E	probably benign	Het
Nsun3	A	T	16: 62,776,300	C152S	possibly damaging	Het
Olfr116	A	G	17: 37,623,706	F310L	probably benign	Het
Opcml	G	A	9: 28,675,211	W75*	probably null	Het
Pcdh7	G	A	5: 57,722,240	E1046K	probably damaging	Het
Pcdhb9	T	A	18: 37,403,281	V776D	probably benign	Het
Pla2g4a	A	G	1: 149,851,352	L551S	probably damaging	Het
Plaa	G	A	4: 94,569,823	Q637*	probably null	Het
Plekhh1	A	T	12: 79,075,430	E1099V	probably damaging	Het
Ppp4r1	A	T	17: 65,829,500	N551Y	probably benign	Het
R3hdm2	T	C	10: 127,484,513	V554A	probably damaging	Het
Rab44	A	G	17: 29,138,176		probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rasgrf2	T	C	13: 91,886,402	T1119A	probably damaging	Het
Rims2	A	G	15: 39,585,648	D1194G	probably damaging	Het
Scarb1	A	T	5: 125,297,230	C280S	probably damaging	Het
Sde2	T	C	1: 180,866,262	F439S	probably damaging	Het
Setd5	T	C	6: 113,115,571	I304T	probably benign	Het
Sipa1l1	A	G	12: 82,403,122	E1106G	probably benign	Het
Sis	T	G	3: 72,903,607	S1694R	probably damaging	Het
Smad9	T	A	3: 54,786,193	F181Y	probably benign	Het
Smg1	A	G	7: 118,198,279		probably benign	Het
Sspo	T	C	6: 48,448,582	Y46H	probably damaging	Het
Tdrd12	A	G	7: 35,478,109	M940T	unknown	Het
Tmem44	G	T	16: 30,547,395	T71K	possibly damaging	Het
Tmf1	T	A	6: 97,156,950	E1009V	probably damaging	Het
Ttc39a	C	T	4: 109,431,566	R288W	probably damaging	Het
Ttc9c	G	A	19: 8,818,827		probably benign	Het
Usp28	T	A	9: 49,039,156	Y634N	probably damaging	Het
Vmn1r211	C	T	13: 22,851,893	M201I	probably benign	Het
Vmn2r54	T	A	7: 12,615,795	Q620L	possibly damaging	Het
Vps13c	T	C	9: 67,923,828	L1580P	probably benign	Het
Vrk3	C	A	7: 44,768,466	F308L	probably damaging	Het
Zfp984	A	T	4: 147,755,545	M283K	probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCACCTCAGATGACTGTCAAAG -3'
(R):5'- TTCCGAAGACTGGTGGCTTC -3'

Sequencing Primer
(F):5'- TCAGATGACTGTCAAAGAAACCAGTG -3'
(R):5'- TGGCTTCTCCAGTTTTCTGTAG -3'

Posted On

2019-05-13