Incidental Mutation 'R7058:Pla2g4a'
ID548026
Institutional Source Beutler Lab
Gene Symbol Pla2g4a
Ensembl Gene ENSMUSG00000056220
Gene Namephospholipase A2, group IVA (cytosolic, calcium-dependent)
SynonymsType IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R7058 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location149829618-149961290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149851352 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 551 (L551S)
Ref Sequence ENSEMBL: ENSMUSP00000107557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]
Predicted Effect probably damaging
Transcript: ENSMUST00000070200
AA Change: L559S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: L559S

DomainStartEndE-ValueType
C2 19 121 8.23e-17 SMART
PLAc 117 668 N/A SMART
Blast:PLAc 706 748 3e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111926
AA Change: L551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: L551S

DomainStartEndE-ValueType
C2 11 113 8.23e-17 SMART
PLAc 109 660 N/A SMART
Blast:PLAc 698 740 3e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
Asxl3 A G 18: 22,517,674 K907E probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Dchs1 A G 7: 105,757,021 C2335R probably benign Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Ggt7 A T 2: 155,503,095 probably null Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Gpd2 G A 2: 57,307,100 probably null Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Hsd3b1 C T 3: 98,857,815 probably null Het
Igsf9b A G 9: 27,322,854 Y421C probably damaging Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Kif21a A T 15: 90,948,903 probably null Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Opcml G A 9: 28,675,211 W75* probably null Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab44 A G 17: 29,138,176 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Pla2g4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Pla2g4a APN 1 149886203 missense probably benign 0.08
IGL00763:Pla2g4a APN 1 149851325 missense probably damaging 1.00
IGL01548:Pla2g4a APN 1 149932656 critical splice donor site probably null
IGL01683:Pla2g4a APN 1 149857654 missense probably benign 0.05
IGL01903:Pla2g4a APN 1 149840619 missense possibly damaging 0.51
IGL02049:Pla2g4a APN 1 149861096 missense probably benign 0.12
IGL02103:Pla2g4a APN 1 149901199 missense probably damaging 0.99
IGL03132:Pla2g4a APN 1 149902284 splice site probably benign
IGL03299:Pla2g4a APN 1 149851367 missense probably damaging 1.00
IGL03302:Pla2g4a APN 1 149864947 missense probably benign 0.00
R0110:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0469:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0488:Pla2g4a UTSW 1 149871445 missense probably damaging 1.00
R0606:Pla2g4a UTSW 1 149840704 missense probably benign 0.44
R1468:Pla2g4a UTSW 1 149887593 splice site probably benign
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1521:Pla2g4a UTSW 1 149857686 critical splice acceptor site probably null
R1718:Pla2g4a UTSW 1 149871523 splice site probably benign
R1778:Pla2g4a UTSW 1 149902445 splice site probably benign
R1967:Pla2g4a UTSW 1 149922081 missense probably damaging 1.00
R2063:Pla2g4a UTSW 1 149840676 missense possibly damaging 0.94
R2291:Pla2g4a UTSW 1 149901189 missense probably damaging 1.00
R3855:Pla2g4a UTSW 1 149830177 missense possibly damaging 0.86
R4512:Pla2g4a UTSW 1 149861051 splice site probably null
R4568:Pla2g4a UTSW 1 149842226 missense probably benign 0.43
R5266:Pla2g4a UTSW 1 149865167 missense possibly damaging 0.79
R5855:Pla2g4a UTSW 1 149880063 missense probably damaging 0.99
R5897:Pla2g4a UTSW 1 149865148 missense probably damaging 0.99
R6012:Pla2g4a UTSW 1 149932677 missense possibly damaging 0.55
R6193:Pla2g4a UTSW 1 149902430 missense probably damaging 1.00
R6246:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6248:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6258:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6260:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6293:Pla2g4a UTSW 1 149880047 missense probably damaging 0.98
R6310:Pla2g4a UTSW 1 149842226 missense possibly damaging 0.88
R6490:Pla2g4a UTSW 1 149851335 nonsense probably null
R6502:Pla2g4a UTSW 1 149872616 nonsense probably null
R6614:Pla2g4a UTSW 1 149842235 missense probably benign 0.07
R6671:Pla2g4a UTSW 1 149887631 missense probably benign
R6745:Pla2g4a UTSW 1 149886230 missense probably benign 0.07
R6880:Pla2g4a UTSW 1 149851451 missense possibly damaging 0.90
R7163:Pla2g4a UTSW 1 149840665 nonsense probably null
R7422:Pla2g4a UTSW 1 149932687 missense probably benign 0.32
R7454:Pla2g4a UTSW 1 149872690 missense possibly damaging 0.63
R7474:Pla2g4a UTSW 1 149865200 missense possibly damaging 0.88
R7514:Pla2g4a UTSW 1 149851362 missense probably damaging 1.00
R7536:Pla2g4a UTSW 1 149880017 missense probably damaging 1.00
R7682:Pla2g4a UTSW 1 149886271 missense probably damaging 1.00
X0021:Pla2g4a UTSW 1 149864926 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGAACTTTTGCCACAATTAGACTG -3'
(R):5'- TGCTCTGCCTCTCAAGTATAAG -3'

Sequencing Primer
(F):5'- CTTACAGGTTAAGAGGCTCAGTCC -3'
(R):5'- CTCTGCCTCTCAAGTATAAGATAAAC -3'
Posted On2019-05-13