Incidental Mutation 'R7058:Hfm1'
ID 548047
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 045155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7058 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107059306 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 239 (S239T)
Ref Sequence ENSEMBL: ENSMUSP00000142727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: S239T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S239T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: S239T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S239T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
AA Change: S239T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410
AA Change: S239T

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,275,554 (GRCm39) I419T possibly damaging Het
Afap1 T C 5: 36,119,604 (GRCm39) V294A probably benign Het
Amotl1 T A 9: 14,486,532 (GRCm39) Q454L possibly damaging Het
Ap2a1 T C 7: 44,550,215 (GRCm39) S961G probably damaging Het
Asxl3 A G 18: 22,650,731 (GRCm39) K907E probably damaging Het
BC028528 A T 3: 95,792,323 (GRCm39) L137I possibly damaging Het
Cand1 A T 10: 119,047,659 (GRCm39) N610K probably benign Het
Cat A G 2: 103,304,698 (GRCm39) I109T probably benign Het
Ccdc18 T C 5: 108,341,664 (GRCm39) V853A probably benign Het
Chd4 C A 6: 125,085,405 (GRCm39) D805E possibly damaging Het
Cnih1 A C 14: 47,017,652 (GRCm39) F77V probably damaging Het
Cntd1 A T 11: 101,178,252 (GRCm39) I284F probably damaging Het
Col6a3 C A 1: 90,755,759 (GRCm39) E177* probably null Het
Cpxm2 T A 7: 131,745,408 (GRCm39) D139V probably benign Het
Cyp1a2 G T 9: 57,584,525 (GRCm39) R510S probably damaging Het
D2hgdh T C 1: 93,763,096 (GRCm39) S294P probably damaging Het
Dchs1 A G 7: 105,406,228 (GRCm39) C2335R probably benign Het
Disc1 G T 8: 125,977,724 (GRCm39) C719F probably damaging Het
Dnah14 A C 1: 181,525,614 (GRCm39) D2180A probably benign Het
Dop1b G A 16: 93,573,878 (GRCm39) R1582Q probably benign Het
Dsg2 A T 18: 20,725,332 (GRCm39) H481L probably benign Het
Epha6 A G 16: 59,503,013 (GRCm39) S965P probably damaging Het
Esrrg G T 1: 187,882,503 (GRCm39) L253F probably damaging Het
Exoc6b T C 6: 84,831,704 (GRCm39) K438R probably damaging Het
Fam98a C A 17: 75,845,384 (GRCm39) R454L unknown Het
Fam98c A T 7: 28,855,308 (GRCm39) probably null Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Galnt13 A G 2: 54,988,587 (GRCm39) T470A probably damaging Het
Ggt7 A T 2: 155,345,015 (GRCm39) probably null Het
Golim4 T C 3: 75,785,957 (GRCm39) E606G probably damaging Het
Gpd2 G A 2: 57,197,112 (GRCm39) probably null Het
Grin2b T C 6: 135,757,304 (GRCm39) M386V probably damaging Het
Hmcn1 G A 1: 150,649,641 (GRCm39) T615I probably benign Het
Hook2 G A 8: 85,724,040 (GRCm39) E446K possibly damaging Het
Hsd3b1 C T 3: 98,765,131 (GRCm39) probably null Het
Igsf9b A G 9: 27,234,150 (GRCm39) Y421C probably damaging Het
Il21 A G 3: 37,286,629 (GRCm39) L29P probably damaging Het
Ildr1 A G 16: 36,542,730 (GRCm39) S421G probably benign Het
Kat2b C A 17: 53,972,894 (GRCm39) T736K probably benign Het
Kcng1 A G 2: 168,104,529 (GRCm39) V439A probably damaging Het
Kif21a A T 15: 90,833,106 (GRCm39) probably null Het
Lat A G 7: 125,968,318 (GRCm39) probably null Het
Mastl T A 2: 23,023,425 (GRCm39) K433* probably null Het
Mettl2 A G 11: 105,019,719 (GRCm39) R119G probably benign Het
Mia2 C T 12: 59,231,021 (GRCm39) P1223L possibly damaging Het
Mkrn2os G T 6: 115,563,635 (GRCm39) D133E probably benign Het
Mslnl A G 17: 25,962,186 (GRCm39) T195A probably benign Het
Muc16 T G 9: 18,551,051 (GRCm39) T5081P probably benign Het
Mylpf G C 7: 126,813,139 (GRCm39) R110P probably damaging Het
Myo19 G T 11: 84,798,194 (GRCm39) C738F possibly damaging Het
Nat8f4 T A 6: 85,878,271 (GRCm39) N84I possibly damaging Het
Nol8 C T 13: 49,829,862 (GRCm39) R1104C probably damaging Het
Notch1 A T 2: 26,353,830 (GRCm39) D1932E probably benign Het
Nsun3 A T 16: 62,596,663 (GRCm39) C152S possibly damaging Het
Opcml G A 9: 28,586,507 (GRCm39) W75* probably null Het
Or14j10 A G 17: 37,934,597 (GRCm39) F310L probably benign Het
Pcdh7 G A 5: 57,879,582 (GRCm39) E1046K probably damaging Het
Pcdhb9 T A 18: 37,536,334 (GRCm39) V776D probably benign Het
Pla2g4a A G 1: 149,727,103 (GRCm39) L551S probably damaging Het
Plaa G A 4: 94,458,060 (GRCm39) Q637* probably null Het
Plekhh1 A T 12: 79,122,204 (GRCm39) E1099V probably damaging Het
Ppp4r1 A T 17: 66,136,495 (GRCm39) N551Y probably benign Het
R3hdm2 T C 10: 127,320,382 (GRCm39) V554A probably damaging Het
Rab44 A G 17: 29,357,150 (GRCm39) probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rasgrf2 T C 13: 92,034,521 (GRCm39) T1119A probably damaging Het
Rims2 A G 15: 39,449,044 (GRCm39) D1194G probably damaging Het
Scarb1 A T 5: 125,374,294 (GRCm39) C280S probably damaging Het
Sde2 T C 1: 180,693,827 (GRCm39) F439S probably damaging Het
Setd5 T C 6: 113,092,532 (GRCm39) I304T probably benign Het
Sipa1l1 A G 12: 82,449,896 (GRCm39) E1106G probably benign Het
Sis T G 3: 72,810,940 (GRCm39) S1694R probably damaging Het
Smad9 T A 3: 54,693,614 (GRCm39) F181Y probably benign Het
Smg1 A G 7: 117,797,502 (GRCm39) probably benign Het
Sspo T C 6: 48,425,516 (GRCm39) Y46H probably damaging Het
Tdrd12 A G 7: 35,177,534 (GRCm39) M940T unknown Het
Tmem44 G T 16: 30,366,213 (GRCm39) T71K possibly damaging Het
Tmf1 T A 6: 97,133,911 (GRCm39) E1009V probably damaging Het
Ttc39a C T 4: 109,288,763 (GRCm39) R288W probably damaging Het
Ttc9c G A 19: 8,796,191 (GRCm39) probably benign Het
Usp28 T A 9: 48,950,456 (GRCm39) Y634N probably damaging Het
Vmn1r211 C T 13: 23,036,063 (GRCm39) M201I probably benign Het
Vmn2r54 T A 7: 12,349,722 (GRCm39) Q620L possibly damaging Het
Vps13c T C 9: 67,831,110 (GRCm39) L1580P probably benign Het
Vrk3 C A 7: 44,417,890 (GRCm39) F308L probably damaging Het
Zdbf2 T A 1: 63,346,563 (GRCm39) H1647Q possibly damaging Het
Zfp984 A T 4: 147,840,002 (GRCm39) M283K probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGAACCTAAGCCATTTGGG -3'
(R):5'- ACTTGAGTTCTCATATCAGCCC -3'

Sequencing Primer
(F):5'- CACTTTCCATAAAAAGCTCCAATAAC -3'
(R):5'- GAGTTCTCATATCAGCCCAGTGAAAC -3'
Posted On 2019-05-13