Mutagenetix > Incidental Mutation

Incidental Mutation 'R7058:Grin2b'

548057

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

045155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7058 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135780306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 386 (M386V)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: M386V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: M386V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: M386V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: M386V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.0815

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	C	7: 41,626,130	I419T	possibly damaging	Het
Afap1	T	C	5: 35,962,260	V294A	probably benign	Het
Amotl1	T	A	9: 14,575,236	Q454L	possibly damaging	Het
Ap2a1	T	C	7: 44,900,791	S961G	probably damaging	Het
Asxl3	A	G	18: 22,517,674	K907E	probably damaging	Het
BC028528	A	T	3: 95,885,011	L137I	possibly damaging	Het
Cand1	A	T	10: 119,211,754	N610K	probably benign	Het
Cat	A	G	2: 103,474,353	I109T	probably benign	Het
Ccdc18	T	C	5: 108,193,798	V853A	probably benign	Het
Chd4	C	A	6: 125,108,442	D805E	possibly damaging	Het
Cnih1	A	C	14: 46,780,195	F77V	probably damaging	Het
Cntd1	A	T	11: 101,287,426	I284F	probably damaging	Het
Col6a3	C	A	1: 90,828,037	E177*	probably null	Het
Cpxm2	T	A	7: 132,143,679	D139V	probably benign	Het
Cyp1a2	G	T	9: 57,677,242	R510S	probably damaging	Het
D2hgdh	T	C	1: 93,835,374	S294P	probably damaging	Het
Dchs1	A	G	7: 105,757,021	C2335R	probably benign	Het
Disc1	G	T	8: 125,250,985	C719F	probably damaging	Het
Dnah14	A	C	1: 181,698,049	D2180A	probably benign	Het
Dopey2	G	A	16: 93,776,990	R1582Q	probably benign	Het
Dsg2	A	T	18: 20,592,275	H481L	probably benign	Het
Epha6	A	G	16: 59,682,650	S965P	probably damaging	Het
Esrrg	G	T	1: 188,150,306	L253F	probably damaging	Het
Exoc6b	T	C	6: 84,854,722	K438R	probably damaging	Het
Fam98a	C	A	17: 75,538,389	R454L	unknown	Het
Fam98c	A	T	7: 29,155,883		probably null	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Galnt13	A	G	2: 55,098,575	T470A	probably damaging	Het
Ggt7	A	T	2: 155,503,095		probably null	Het
Golim4	T	C	3: 75,878,650	E606G	probably damaging	Het
Gpd2	G	A	2: 57,307,100		probably null	Het
Hfm1	A	T	5: 106,911,440	S239T	probably benign	Het
Hmcn1	G	A	1: 150,773,890	T615I	probably benign	Het
Hook2	G	A	8: 84,997,411	E446K	possibly damaging	Het
Hsd3b1	C	T	3: 98,857,815		probably null	Het
Igsf9b	A	G	9: 27,322,854	Y421C	probably damaging	Het
Il21	A	G	3: 37,232,480	L29P	probably damaging	Het
Ildr1	A	G	16: 36,722,368	S421G	probably benign	Het
Kat2b	C	A	17: 53,665,866	T736K	probably benign	Het
Kcng1	A	G	2: 168,262,609	V439A	probably damaging	Het
Kif21a	A	T	15: 90,948,903		probably null	Het
Lat	A	G	7: 126,369,146		probably null	Het
Mastl	T	A	2: 23,133,413	K433*	probably null	Het
Mettl2	A	G	11: 105,128,893	R119G	probably benign	Het
Mia2	C	T	12: 59,184,235	P1223L	possibly damaging	Het
Mkrn2os	G	T	6: 115,586,674	D133E	probably benign	Het
Mslnl	A	G	17: 25,743,212	T195A	probably benign	Het
Muc16	T	G	9: 18,639,755	T5081P	probably benign	Het
Mylpf	G	C	7: 127,213,967	R110P	probably damaging	Het
Myo19	G	T	11: 84,907,368	C738F	possibly damaging	Het
Nat8f4	T	A	6: 85,901,289	N84I	possibly damaging	Het
Nol8	C	T	13: 49,676,386	R1104C	probably damaging	Het
Notch1	A	T	2: 26,463,818	D1932E	probably benign	Het
Nsun3	A	T	16: 62,776,300	C152S	possibly damaging	Het
Olfr116	A	G	17: 37,623,706	F310L	probably benign	Het
Opcml	G	A	9: 28,675,211	W75*	probably null	Het
Pcdh7	G	A	5: 57,722,240	E1046K	probably damaging	Het
Pcdhb9	T	A	18: 37,403,281	V776D	probably benign	Het
Pla2g4a	A	G	1: 149,851,352	L551S	probably damaging	Het
Plaa	G	A	4: 94,569,823	Q637*	probably null	Het
Plekhh1	A	T	12: 79,075,430	E1099V	probably damaging	Het
Ppp4r1	A	T	17: 65,829,500	N551Y	probably benign	Het
R3hdm2	T	C	10: 127,484,513	V554A	probably damaging	Het
Rab44	A	G	17: 29,138,176		probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rasgrf2	T	C	13: 91,886,402	T1119A	probably damaging	Het
Rims2	A	G	15: 39,585,648	D1194G	probably damaging	Het
Scarb1	A	T	5: 125,297,230	C280S	probably damaging	Het
Sde2	T	C	1: 180,866,262	F439S	probably damaging	Het
Setd5	T	C	6: 113,115,571	I304T	probably benign	Het
Sipa1l1	A	G	12: 82,403,122	E1106G	probably benign	Het
Sis	T	G	3: 72,903,607	S1694R	probably damaging	Het
Smad9	T	A	3: 54,786,193	F181Y	probably benign	Het
Smg1	A	G	7: 118,198,279		probably benign	Het
Sspo	T	C	6: 48,448,582	Y46H	probably damaging	Het
Tdrd12	A	G	7: 35,478,109	M940T	unknown	Het
Tmem44	G	T	16: 30,547,395	T71K	possibly damaging	Het
Tmf1	T	A	6: 97,156,950	E1009V	probably damaging	Het
Ttc39a	C	T	4: 109,431,566	R288W	probably damaging	Het
Ttc9c	G	A	19: 8,818,827		probably benign	Het
Usp28	T	A	9: 49,039,156	Y634N	probably damaging	Het
Vmn1r211	C	T	13: 22,851,893	M201I	probably benign	Het
Vmn2r54	T	A	7: 12,615,795	Q620L	possibly damaging	Het
Vps13c	T	C	9: 67,923,828	L1580P	probably benign	Het
Vrk3	C	A	7: 44,768,466	F308L	probably damaging	Het
Zdbf2	T	A	1: 63,307,404	H1647Q	possibly damaging	Het
Zfp984	A	T	4: 147,755,545	M283K	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCACATCTGACTCTCCTGG -3'
(R):5'- AGAAACTATTCTTTCCATCGTGGTCTG -3'

Sequencing Primer
(F):5'- GTGTCATACTCAGAGATGATGCGC -3'
(R):5'- CCATCGTGGTCTGTGCTG -3'

Posted On

2019-05-13