Incidental Mutation 'R7058:Igsf9b'
ID 548073
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Name immunoglobulin superfamily, member 9B
Synonyms LOC235086
MMRRC Submission 045155-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R7058 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 27299204-27357546 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27322854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 421 (Y421C)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
AlphaFold E9PZ19
Predicted Effect probably damaging
Transcript: ENSMUST00000115247
AA Change: Y421C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: Y421C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133213
AA Change: Y421C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: Y421C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214357
AA Change: Y421C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
Asxl3 A G 18: 22,517,674 K907E probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Dchs1 A G 7: 105,757,021 C2335R probably benign Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Ggt7 A T 2: 155,503,095 probably null Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Gpd2 G A 2: 57,307,100 probably null Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Hsd3b1 C T 3: 98,857,815 probably null Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Kif21a A T 15: 90,948,903 probably null Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Opcml G A 9: 28,675,211 W75* probably null Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Pla2g4a A G 1: 149,851,352 L551S probably damaging Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab44 A G 17: 29,138,176 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
G1Funyon:Igsf9b UTSW 9 27334739 utr 3 prime probably benign
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 splice site probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27334337 missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R8072:Igsf9b UTSW 9 27317364 missense possibly damaging 0.94
R8163:Igsf9b UTSW 9 27322611 splice site probably null
R8301:Igsf9b UTSW 9 27334739 utr 3 prime probably benign
R8546:Igsf9b UTSW 9 27333130 missense possibly damaging 0.54
R8553:Igsf9b UTSW 9 27333443 missense probably damaging 0.96
R9438:Igsf9b UTSW 9 27332543 missense probably benign 0.03
R9585:Igsf9b UTSW 9 27322236 missense probably damaging 1.00
R9720:Igsf9b UTSW 9 27309514 missense probably damaging 0.99
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Z1176:Igsf9b UTSW 9 27317353 critical splice acceptor site probably null
Z1177:Igsf9b UTSW 9 27334292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCGCATTGAGGAGGCC -3'
(R):5'- AACATCTGGCCTGTCCACAC -3'

Sequencing Primer
(F):5'- AGAGGAGGCTCTTGGCACTTAC -3'
(R):5'- TGTCCACACTGGTCCAAGTAG -3'
Posted On 2019-05-13