Incidental Mutation 'R7058:Igsf9b'
ID 548073
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Name immunoglobulin superfamily, member 9B
Synonyms AI414108, LOC235086
MMRRC Submission 045155-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.529) question?
Stock # R7058 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 27210500-27268842 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27234150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 421 (Y421C)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
AlphaFold E9PZ19
Predicted Effect probably damaging
Transcript: ENSMUST00000115247
AA Change: Y421C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: Y421C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133213
AA Change: Y421C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: Y421C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214357
AA Change: Y421C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,275,554 (GRCm39) I419T possibly damaging Het
Afap1 T C 5: 36,119,604 (GRCm39) V294A probably benign Het
Amotl1 T A 9: 14,486,532 (GRCm39) Q454L possibly damaging Het
Ap2a1 T C 7: 44,550,215 (GRCm39) S961G probably damaging Het
Asxl3 A G 18: 22,650,731 (GRCm39) K907E probably damaging Het
BC028528 A T 3: 95,792,323 (GRCm39) L137I possibly damaging Het
Cand1 A T 10: 119,047,659 (GRCm39) N610K probably benign Het
Cat A G 2: 103,304,698 (GRCm39) I109T probably benign Het
Ccdc18 T C 5: 108,341,664 (GRCm39) V853A probably benign Het
Chd4 C A 6: 125,085,405 (GRCm39) D805E possibly damaging Het
Cnih1 A C 14: 47,017,652 (GRCm39) F77V probably damaging Het
Cntd1 A T 11: 101,178,252 (GRCm39) I284F probably damaging Het
Col6a3 C A 1: 90,755,759 (GRCm39) E177* probably null Het
Cpxm2 T A 7: 131,745,408 (GRCm39) D139V probably benign Het
Cyp1a2 G T 9: 57,584,525 (GRCm39) R510S probably damaging Het
D2hgdh T C 1: 93,763,096 (GRCm39) S294P probably damaging Het
Dchs1 A G 7: 105,406,228 (GRCm39) C2335R probably benign Het
Disc1 G T 8: 125,977,724 (GRCm39) C719F probably damaging Het
Dnah14 A C 1: 181,525,614 (GRCm39) D2180A probably benign Het
Dop1b G A 16: 93,573,878 (GRCm39) R1582Q probably benign Het
Dsg2 A T 18: 20,725,332 (GRCm39) H481L probably benign Het
Epha6 A G 16: 59,503,013 (GRCm39) S965P probably damaging Het
Esrrg G T 1: 187,882,503 (GRCm39) L253F probably damaging Het
Exoc6b T C 6: 84,831,704 (GRCm39) K438R probably damaging Het
Fam98a C A 17: 75,845,384 (GRCm39) R454L unknown Het
Fam98c A T 7: 28,855,308 (GRCm39) probably null Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Galnt13 A G 2: 54,988,587 (GRCm39) T470A probably damaging Het
Ggt7 A T 2: 155,345,015 (GRCm39) probably null Het
Golim4 T C 3: 75,785,957 (GRCm39) E606G probably damaging Het
Gpd2 G A 2: 57,197,112 (GRCm39) probably null Het
Grin2b T C 6: 135,757,304 (GRCm39) M386V probably damaging Het
Hfm1 A T 5: 107,059,306 (GRCm39) S239T probably benign Het
Hmcn1 G A 1: 150,649,641 (GRCm39) T615I probably benign Het
Hook2 G A 8: 85,724,040 (GRCm39) E446K possibly damaging Het
Hsd3b1 C T 3: 98,765,131 (GRCm39) probably null Het
Il21 A G 3: 37,286,629 (GRCm39) L29P probably damaging Het
Ildr1 A G 16: 36,542,730 (GRCm39) S421G probably benign Het
Kat2b C A 17: 53,972,894 (GRCm39) T736K probably benign Het
Kcng1 A G 2: 168,104,529 (GRCm39) V439A probably damaging Het
Kif21a A T 15: 90,833,106 (GRCm39) probably null Het
Lat A G 7: 125,968,318 (GRCm39) probably null Het
Mastl T A 2: 23,023,425 (GRCm39) K433* probably null Het
Mettl2 A G 11: 105,019,719 (GRCm39) R119G probably benign Het
Mia2 C T 12: 59,231,021 (GRCm39) P1223L possibly damaging Het
Mkrn2os G T 6: 115,563,635 (GRCm39) D133E probably benign Het
Mslnl A G 17: 25,962,186 (GRCm39) T195A probably benign Het
Muc16 T G 9: 18,551,051 (GRCm39) T5081P probably benign Het
Mylpf G C 7: 126,813,139 (GRCm39) R110P probably damaging Het
Myo19 G T 11: 84,798,194 (GRCm39) C738F possibly damaging Het
Nat8f4 T A 6: 85,878,271 (GRCm39) N84I possibly damaging Het
Nol8 C T 13: 49,829,862 (GRCm39) R1104C probably damaging Het
Notch1 A T 2: 26,353,830 (GRCm39) D1932E probably benign Het
Nsun3 A T 16: 62,596,663 (GRCm39) C152S possibly damaging Het
Opcml G A 9: 28,586,507 (GRCm39) W75* probably null Het
Or14j10 A G 17: 37,934,597 (GRCm39) F310L probably benign Het
Pcdh7 G A 5: 57,879,582 (GRCm39) E1046K probably damaging Het
Pcdhb9 T A 18: 37,536,334 (GRCm39) V776D probably benign Het
Pla2g4a A G 1: 149,727,103 (GRCm39) L551S probably damaging Het
Plaa G A 4: 94,458,060 (GRCm39) Q637* probably null Het
Plekhh1 A T 12: 79,122,204 (GRCm39) E1099V probably damaging Het
Ppp4r1 A T 17: 66,136,495 (GRCm39) N551Y probably benign Het
R3hdm2 T C 10: 127,320,382 (GRCm39) V554A probably damaging Het
Rab44 A G 17: 29,357,150 (GRCm39) probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rasgrf2 T C 13: 92,034,521 (GRCm39) T1119A probably damaging Het
Rims2 A G 15: 39,449,044 (GRCm39) D1194G probably damaging Het
Scarb1 A T 5: 125,374,294 (GRCm39) C280S probably damaging Het
Sde2 T C 1: 180,693,827 (GRCm39) F439S probably damaging Het
Setd5 T C 6: 113,092,532 (GRCm39) I304T probably benign Het
Sipa1l1 A G 12: 82,449,896 (GRCm39) E1106G probably benign Het
Sis T G 3: 72,810,940 (GRCm39) S1694R probably damaging Het
Smad9 T A 3: 54,693,614 (GRCm39) F181Y probably benign Het
Smg1 A G 7: 117,797,502 (GRCm39) probably benign Het
Sspo T C 6: 48,425,516 (GRCm39) Y46H probably damaging Het
Tdrd12 A G 7: 35,177,534 (GRCm39) M940T unknown Het
Tmem44 G T 16: 30,366,213 (GRCm39) T71K possibly damaging Het
Tmf1 T A 6: 97,133,911 (GRCm39) E1009V probably damaging Het
Ttc39a C T 4: 109,288,763 (GRCm39) R288W probably damaging Het
Ttc9c G A 19: 8,796,191 (GRCm39) probably benign Het
Usp28 T A 9: 48,950,456 (GRCm39) Y634N probably damaging Het
Vmn1r211 C T 13: 23,036,063 (GRCm39) M201I probably benign Het
Vmn2r54 T A 7: 12,349,722 (GRCm39) Q620L possibly damaging Het
Vps13c T C 9: 67,831,110 (GRCm39) L1580P probably benign Het
Vrk3 C A 7: 44,417,890 (GRCm39) F308L probably damaging Het
Zdbf2 T A 1: 63,346,563 (GRCm39) H1647Q possibly damaging Het
Zfp984 A T 4: 147,840,002 (GRCm39) M283K probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27,230,951 (GRCm39) missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27,245,600 (GRCm39) missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27,239,902 (GRCm39) missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27,244,426 (GRCm39) missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27,244,378 (GRCm39) missense probably damaging 0.98
G1Funyon:Igsf9b UTSW 9 27,246,035 (GRCm39) utr 3 prime probably benign
IGL03014:Igsf9b UTSW 9 27,233,932 (GRCm39) missense probably benign 0.00
R0127:Igsf9b UTSW 9 27,245,681 (GRCm39) missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27,245,878 (GRCm39) missense probably benign 0.01
R0520:Igsf9b UTSW 9 27,234,546 (GRCm39) missense probably benign 0.00
R0534:Igsf9b UTSW 9 27,244,358 (GRCm39) splice site probably null
R0613:Igsf9b UTSW 9 27,238,216 (GRCm39) missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27,234,657 (GRCm39) critical splice donor site probably null
R0828:Igsf9b UTSW 9 27,230,901 (GRCm39) nonsense probably null
R0879:Igsf9b UTSW 9 27,245,038 (GRCm39) missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27,230,612 (GRCm39) missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27,243,849 (GRCm39) splice site probably null
R1162:Igsf9b UTSW 9 27,238,185 (GRCm39) missense probably benign
R1758:Igsf9b UTSW 9 27,245,548 (GRCm39) missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27,229,123 (GRCm39) missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27,222,889 (GRCm39) missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27,243,028 (GRCm39) missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27,233,535 (GRCm39) missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27,245,633 (GRCm39) missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27,244,792 (GRCm39) missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27,244,792 (GRCm39) missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27,233,519 (GRCm39) missense probably benign 0.11
R2872:Igsf9b UTSW 9 27,233,519 (GRCm39) missense probably benign 0.11
R3415:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27,245,873 (GRCm39) missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27,234,213 (GRCm39) missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27,245,548 (GRCm39) missense probably benign 0.13
R4446:Igsf9b UTSW 9 27,245,548 (GRCm39) missense probably benign 0.13
R4787:Igsf9b UTSW 9 27,228,752 (GRCm39) missense probably benign 0.26
R4887:Igsf9b UTSW 9 27,233,946 (GRCm39) missense probably benign 0.45
R5085:Igsf9b UTSW 9 27,228,733 (GRCm39) missense probably benign 0.03
R5360:Igsf9b UTSW 9 27,222,968 (GRCm39) missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27,245,572 (GRCm39) small insertion probably benign
R5686:Igsf9b UTSW 9 27,235,475 (GRCm39) missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27,239,826 (GRCm39) missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27,234,531 (GRCm39) missense probably benign 0.44
R6304:Igsf9b UTSW 9 27,253,871 (GRCm39) missense probably benign 0.19
R6359:Igsf9b UTSW 9 27,220,895 (GRCm39) missense probably benign 0.25
R6367:Igsf9b UTSW 9 27,220,821 (GRCm39) nonsense probably null
R6556:Igsf9b UTSW 9 27,240,851 (GRCm39) missense probably damaging 1.00
R7165:Igsf9b UTSW 9 27,245,536 (GRCm39) missense probably benign
R7180:Igsf9b UTSW 9 27,233,964 (GRCm39) missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27,242,992 (GRCm39) missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27,245,418 (GRCm39) missense probably benign 0.10
R7605:Igsf9b UTSW 9 27,234,608 (GRCm39) missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27,257,186 (GRCm39) missense probably benign
R7613:Igsf9b UTSW 9 27,245,418 (GRCm39) missense probably benign 0.10
R8072:Igsf9b UTSW 9 27,228,660 (GRCm39) missense possibly damaging 0.94
R8163:Igsf9b UTSW 9 27,233,907 (GRCm39) splice site probably null
R8301:Igsf9b UTSW 9 27,246,035 (GRCm39) utr 3 prime probably benign
R8546:Igsf9b UTSW 9 27,244,426 (GRCm39) missense possibly damaging 0.54
R8553:Igsf9b UTSW 9 27,244,739 (GRCm39) missense probably damaging 0.96
R9438:Igsf9b UTSW 9 27,243,839 (GRCm39) missense probably benign 0.03
R9585:Igsf9b UTSW 9 27,233,532 (GRCm39) missense probably damaging 1.00
R9720:Igsf9b UTSW 9 27,220,810 (GRCm39) missense probably damaging 0.99
X0013:Igsf9b UTSW 9 27,243,021 (GRCm39) missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27,220,757 (GRCm39) missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27,245,668 (GRCm39) missense probably damaging 1.00
Z1176:Igsf9b UTSW 9 27,228,649 (GRCm39) critical splice acceptor site probably null
Z1177:Igsf9b UTSW 9 27,245,588 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCGCATTGAGGAGGCC -3'
(R):5'- AACATCTGGCCTGTCCACAC -3'

Sequencing Primer
(F):5'- AGAGGAGGCTCTTGGCACTTAC -3'
(R):5'- TGTCCACACTGGTCCAAGTAG -3'
Posted On 2019-05-13