Incidental Mutation 'R7058:Opcml'
ID548074
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7058 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 28675211 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 75 (W75*)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect probably null
Transcript: ENSMUST00000073822
AA Change: W82*
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: W82*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115243
AA Change: W75*
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: W75*

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
Asxl3 A G 18: 22,517,674 K907E probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Dchs1 A G 7: 105,757,021 C2335R probably benign Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Ggt7 A T 2: 155,503,095 probably null Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Gpd2 G A 2: 57,307,100 probably null Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Hsd3b1 C T 3: 98,857,815 probably null Het
Igsf9b A G 9: 27,322,854 Y421C probably damaging Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Kif21a A T 15: 90,948,903 probably null Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Pla2g4a A G 1: 149,851,352 L551S probably damaging Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab44 A G 17: 29,138,176 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7559:Opcml UTSW 9 28903324 missense probably benign
R8050:Opcml UTSW 9 28813344 missense probably damaging 0.97
R8250:Opcml UTSW 9 28675270 missense probably damaging 1.00
Z1177:Opcml UTSW 9 28404377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTGCCTTGTGTTCAGGAAG -3'
(R):5'- CCAGCTGTAACTTACCTTGCAC -3'

Sequencing Primer
(F):5'- TTCTCCTGGCCATATAAAAACACATG -3'
(R):5'- TACCTTGCACTATGAGATGGACC -3'
Posted On2019-05-13